CSRP3 cDNA ORF Clone, Human, C-His tag

Cat: HG14006-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CSRP3 Reagents

CRO Services

Product recommended


All CSRP3 Reagents

CSRP3 cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
585 bp
Description
Full length Clone DNA of Human cysteine and glycine-rich protein 3 (cardiac LIM protein) with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CSRP3 cDNA ORF Clone, Human, C-His tag Alternative Names

CLP cDNA ORF Clone, Human;CMD1M cDNA ORF Clone, Human;CMH12 cDNA ORF Clone, Human;CRP3 cDNA ORF Clone, Human;LMO4 cDNA ORF Clone, Human;MLP cDNA ORF Clone, Human

CSRP3 Background Information

Full Name
cysteine and glycine rich protein 3

CSRP3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CSRP3 cDNA ORF Clone in Cloning Vector, Rat RG83620-U
CSRP3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83620-ACGLN

CSRP3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CSRP3 cDNA ORF Clone in Cloning Vector, Mouse MG53558-G
CSRP3 cDNA ORF Clone, Mouse, untagged MG53558-UT
CSRP3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53558-ACG
CSRP3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53558-ACGLN
CSRP3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53558-ANG
CSRP3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53558-ACR
CSRP3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53558-ANR
CSRP3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53558-CF
CSRP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53558-NF
CSRP3 cDNA ORF Clone, Mouse, C-His tag MG53558-CH
CSRP3 cDNA ORF Clone, Mouse, N-His tag MG53558-NH
CSRP3 cDNA ORF Clone, Mouse, C-HA tag MG53558-CY
CSRP3 cDNA ORF Clone, Mouse, N-HA tag MG53558-NY
CSRP3 cDNA ORF Clone, Mouse, C-Myc tag MG53558-CM
CSRP3 cDNA ORF Clone, Mouse, N-Myc tag MG53558-NM

CSRP3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CSRP3 cDNA ORF Clone in Cloning Vector, Human HG14006-G
CSRP3 cDNA ORF Clone, Human, untagged HG14006-UT
CSRP3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14006-ACGLN
CSRP3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14006-ACG
CSRP3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14006-ANG
CSRP3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14006-ACR
CSRP3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14006-ANR
CSRP3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14006-CF
CSRP3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14006-NF
CSRP3 cDNA ORF Clone, Human, N-His tag HG14006-NH
CSRP3 cDNA ORF Clone, Human, C-HA tag HG14006-CY
CSRP3 cDNA ORF Clone, Human, N-HA tag HG14006-NY
CSRP3 cDNA ORF Clone, Human, C-Myc tag HG14006-CM
CSRP3 cDNA ORF Clone, Human, N-Myc tag HG14006-NM
CSRP3 qPCR Primer Pairs, Human HP102662
info info
添加购物车成功! 添加购物车失败!