CTLA-4 cDNA ORF Clone, Human, N-HA tag

Cat: HG11159-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CTLA-4 Reagents

CRO Services

Product recommended


All CTLA-4 Reagents

CTLA-4 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
672 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human cytotoxic T-lymphocyte-associated protein 4, transcript variant 1 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.66kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CTLA-4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CTLA-4 cDNA ORF Clone, Human, N-HA tag Validated Images

Rhesus CD3d/CD3 delta Gene Plasmid Map 5616
Human CTLA-4/CD152 Gene Expression validated Image 16828
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-HA Tag monoclonal antibody (100028-MM10) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

CTLA-4 cDNA ORF Clone, Human, N-HA tag Alternative Names

ALPS5 cDNA ORF Clone, Human;CD cDNA ORF Clone, Human;CD152 cDNA ORF Clone, Human;CELIAC3 cDNA ORF Clone, Human;CTLA-4 cDNA ORF Clone, Human;GRD4 cDNA ORF Clone, Human;GSE cDNA ORF Clone, Human;IDDM12 cDNA ORF Clone, Human

CTLA-4 Background Information

Cytotoxic T-lymphocyte protein 4, also known as CTLA4 and CD152, is a single-pass type I membrane protein and a member of the immunoglobulin superfamily. It is the second member of the CD28 receptor family. The ligands or counterreceptors for these two proteins are the B7 family members, CD80 (B7-1) and CD86 (B7-2). CTLA4 transmits an inhibitory signal to T cells, whereas CD28 transmits a stimulatory signal. Intracellular CTLA4 is also found in regulatory T cells and may play an important role in their functions. CD152 or cytotoxic T lymphocyte antigen-4 (CTLA-4) is an essential receptor involved in the negative regulation of T cell activation. Because of its profound inhibitory role, CD152 has been considered a sound susceptible candidate in autoimmunity and a persuasive target for cancer immunotherapy. In particular, recent evidence suggests that CD152 is also important in the homeostasis and function of a population of suppressive cells, termed regulatory T cells (Treg).

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins   CTLA4 / CD152 Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
cytotoxic T-lymphocyte-associated protein 4
References
  • Slavik JM, et al. (1999) CD28/CTLA-4 and CD80/CD86 families: signaling and function. Immunol Res. 19(1): 1-24.
  • Holmberg D, et al. (2005) CTLA-4 (CD152) and its involvement in autoimmune disease. Autoimmunity. 38(3): 225-33.
  • Chin LT, et al. (2008) Immune intervention with monoclonal antibodies targeting CD152 (CTLA-4) for autoimmune and malignant diseases. Chang Gung Med J. 31(1): 1-15.
  • CTLA-4 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    CTLA-4 cDNA ORF Clone in Cloning Vector, Canine DG70113-G

    CTLA-4 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CTLA-4 cDNA ORF Clone, Rhesus, untagged CG90213-UT
    CTLA-4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90213-ACGLN

    CTLA-4 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CTLA-4 cDNA ORF Clone in Cloning Vector, Rat RG81069-G

    CTLA-4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CTLA-4 cDNA ORF Clone in Cloning Vector, Mouse MG50503-M
    CTLA-4 cDNA ORF Clone, Mouse, untagged MG50503-UT
    CTLA-4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50503-ACG
    CTLA-4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50503-ACGLN
    CTLA-4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50503-ACR
    CTLA-4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50503-CF
    CTLA-4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50503-NF
    CTLA-4 cDNA ORF Clone, Mouse, C-His tag MG50503-CH
    CTLA-4 cDNA ORF Clone, Mouse, N-His tag MG50503-NH
    CTLA-4 cDNA ORF Clone, Mouse, C-HA tag MG50503-CY
    CTLA-4 cDNA ORF Clone, Mouse, N-HA tag MG50503-NY
    CTLA-4 cDNA ORF Clone, Mouse, C-Myc tag MG50503-CM
    CTLA-4 cDNA ORF Clone, Mouse, N-Myc tag MG50503-NM
    CTLA-4 qPCR Primer Pairs, Mouse MP200096

    CTLA-4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CTLA-4 cDNA ORF Clone in Cloning Vector, Human HG11159-G
    CTLA-4 cDNA ORF Clone, Human, untagged HG11159-UT
    CTLA-4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11159-ACGLN
    CTLA-4 cDNA ORF Clone, Human, C-GFPSpark® tag HG11159-ACG
    CTLA-4 cDNA ORF Clone, Human, C-OFPSpark® tag HG11159-ACR
    CTLA-4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11159-CF
    CTLA-4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11159-NF
    CTLA-4 cDNA ORF Clone, Human, C-His tag HG11159-CH
    CTLA-4 cDNA ORF Clone, Human, N-His tag HG11159-NH
    CTLA-4 cDNA ORF Clone, Human, C-HA tag HG11159-CY
    CTLA-4 cDNA ORF Clone, Human, C-Myc tag HG11159-CM
    CTLA-4 cDNA ORF Clone, Human, N-Myc tag HG11159-NM
    CTLA-4 qPCR Primer Pairs, Human HP101067
    info info
    添加购物车成功! 添加购物车失败!