휴먼 Cathepsin V/Cathepsin L2/Preproprotein Gene ORF cDNA clone expression plasmid, N-His 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 CTSV cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_001333.2
    cDNA 크기:1005bp
    cDNA 설명:Full length Clone DNA of Homo sapiens Homo sapiens cathepsin L2 with N terminal His tag.
    유전자 동의어:CTSL2, CTSU, CTSV, CATL2, MGC125957
    :Human
    벡터:pCMV3-SP-N-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CTSV qPCR primers for gene expression analysis, HP100176 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    휴먼 Cathepsin V/Cathepsin L2/Preproprotein Gene ORF cDNA clone expression plasmid, N-His 태그 on other vectors
    Product nameProduct name
    연구배경

    Cathepsin V (CTSV), also known as Cathepsin L2, CTSL2, and CATL2, is a member of the peptidase C1 family. It is predominantly expressed in the thymus and testis. Cathepsin V is also expressed in corneal epithelium, and to a lesser extent in conjuctival epithelium and skin. It is a lysosomal cysteine proteinase that may play an important role in corneal physiology. It has about 75% protein sequence identity to murine cathepsin L. The fold of this enzyme is similar to the fold adopted by other members of the papain superfamily of cysteine proteases. Cathepsin V has been recently described as highly homologous to Cathepsin L and exclusively expressed in human thymus and testis. Cathepsin V is the dominant cysteine protease in cortical human thymic epithelial cells, while Cathepsin L and Cathepsin S seem to be restricted to dendritic and macrophage-like cells. Active Cathepsin V in thymic lysosomal preparations was demonstrated by active-site labeling. Recombinant Cathepsin V was capable of converting Ii into CLIP efficiently, suggesting that it is the protease that controls the generation of alphabeta-CLIP complexes in the human thymus. Cathepsin V is the third elastolytic cysteine protease which exhibits the most potent elastase activity yet described among human proteases and that it is present in atherosclerotic plaque specimens. Cathepsin L2 may play a specialized role in the thymus and testis. Expression analysis of cathepsin L2 in human tumors revealed a widespread expression in colorectal and breast carcinomas but not in normal colon or mammary gland or in peritumoral tissues. Cathepsin L2 was also expressed by colorectal and breast cancer cell lines as well as by some tumors of diverse origin, including ovarian and renal carcinomas.

    참고자료
  • Itoh R, et al. (1999) Genomic organization and chromosomal localization of the human cathepsin L2 gene. DNA Res. 6(2): 137-40.
  • Tolosa E, et al. (2003) Cathepsin V is involved in the degradation of invariant chain in human thymus and is overexpressed in myasthenia gravis. J Clin Invest. 112(4): 517-26.
  • Yasuda Y, et al. (2004) Cathepsin V, a novel and potent elastolytic activity expressed in activated macrophages. J Biol Chem. 279(35): 36761-70.
  • Puzer L, et al. (2008) Cathepsin V, but not cathepsins L, B and K, may release angiostatin-like fragments from plasminogen. Biol Chem. 389(2): 195-200.
  • Size / Price
    Cat No: HG10093-NH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".