After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human CXADR ORF mammalian expression plasmid, N-Myc tag

데이터시트리뷰관련제품프로토콜
Human CXADR cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001338.3
cDNA 크기:1098bp
cDNA 설명:Full length Clone DNA of Homo sapiens coxsackie virus and adenovirus receptor with N terminal Myc tag.
유전자 동의어:CAR, HCAR
:Human
벡터:pCMV3-SP-N-Myc
Plasmid:pCMV3-Myc-CXADR
제한 사이트:KpnI + XbaI (6kb + 1.13kb)
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human CXADR Gene Plasmid Map
Human CXADR natural ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

CXADR (coxsackie virus and adenovirus receptor), also known as CAR, is a type I  transmembrane glycoprotein belonging to the CTX family of the Ig superfamily, and is essential for normal cardiac development in the mouse. Proposed as a homophilic cell adhesion molecule, CXADR is a component of the epithelial apical junction complex that is essential for the tight junction integrity, and probably involved in transepithelial migration of polymorphonuclear leukocytes (PMN). Mature mouse CXADR structrually comprises a 218 aa extracellular domain (ECD) with a V-type (D1) and a C2-type (D2) Ig-like domain, a 21 aa transmembrane segment and a 107 aa intracellular domain, among which,D1 is thought to be responsible for homodimer formation in trans within tight junctions. The ECD of mouse CXADR shares 97%, 90% sequence identity with the corresponding regions of rat, human CXADR.

참고자료
  • Tomko, R.P. et al., 1997, Proc. Natl. Acad. Sci. U.S.A. 94 (7): 3352–3356.
  • van Raaij , M.J. et al., 2001, Structure. 8 (11): 1147–1155.
  • Cohen, C.J. et al., 2001, J. Biol. Chem. 276 (27): 25392–25398.
  • Carson, S.D. et al., 2002, Rev. Med. Virol. 11 (4): 219–226.
  • Selinka, H.C. et al., 2004, Med. Microbiol. Immunol. 193 (2-3): 127–131.
  • Philipson, L. et al., 2004, Curr. Top. Microbiol. Immunol. 273:87-111.
  • Raschperger, E. et al., 2006, Exp. Cell Res. 312: 1566-1580.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".