After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 CXCL2/MIP-2 Gene ORF cDNA clone expression plasmid, C-Myc 태그

데이터시트리뷰관련제품프로토콜
Human CXCL2 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_002089.3
cDNA 크기:324bp
cDNA 설명:Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 2 with C terminal Myc tag.
유전자 동의어:GRO2, GROb, MIP2, MIP2A, SCYB2, MGSA-b, MIP-2a, CINC-2a
:Human
벡터:pCMV3-C-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

Chemokine (C-X-C motif) ligand 2 (CXCL2), also called macrophage inflammatory protein 2 (MIP-2), Growth-regulated protein beta (Gro-beta) and Gro oncogene-2 (Gro-2), is a small cytokine belonging to the CXC chemokine family. CXCL2/MIP-2 is selectively up-regulated in tolerance-conferring APCs and serves to recruit NKT cells to the splenic marginal zone, where they form clusters with APCs and T cells. In the absence of the high-affinity receptor for CXCL2/MIP-2 or in the presence of a blocking Ab to CXCL2/MIP-2, peripheral tolerance is prevented, and Ag-specific T regulatory cells are not generated. CXCL2/MIP-2 is selectively up-regulated in tolerance-conferring APCs and serves to recruit NKT cells to the splenic marginal zone, where they form clusters with APCs and T cells. In the absence of the high-affinity receptor for MIP-2 (as in CXCR2-deficient mice) or in the presence of a blocking Ab to MIP-2, peripheral tolerance is prevented, and Ag-specific T regulatory cells are not generated. Understanding the regulation of lymphocyte traffic during tolerance induction may lead to novel therapies for autoimmunity, graft acceptance, and tumor rejection. Several studies have implicated the CXCL2 chemokine as a mediator in the development of sepsis. CXCL2/MIP-2 also plays a major role in mediating the neutrophilic inflammatory response of the rodent lung to particles such as quartz, crocidolite asbestos, as well as high doses of other relative innocuous dusts such as titanium dioxide.

참고자료
  • Driscoll KE. (2000) TNFalpha and MIP-2: role in particle-induced inflammation and regulation by oxidative stress. Toxicol Lett. 112-113: 177-83.
  • Walpen S, et al. (2001) Nitric oxide induces MIP-2 transcription in rat renal mesangial cells and in a rat model of glomerulonephritis. FASEB J. 15(3): 571-3.
  • Fahey TJ, et al. (1990) Cytokine production in a model of wound healing: the appearance of MIP-1, MIP-2, cachectin/TNF and IL-1. Cytokine. 2(2): 92-9.
  • Size / Price
    Cat No: HG10586-CM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".