After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human CYP2D6 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000106.4
cDNA 크기:1494bp
cDNA 설명:Full length Clone DNA of Homo sapiens cytochrome P450, family 2, subfamily D, polypeptide 6.
유전자 동의어:CPD6, CYP2D, CYP2DL1, CYPIID6, P450C2D, P450DB1, CYP2D7AP, CYP2D7BP, CYP2D7P2, CYP2D8P2, P450-DB1, MGC120389, MGC120390, CYP2D6
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-CYP2D6
제한 사이트:KpnI + XbaI (6.1kb + 1.49kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid on other vectors
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG12022-ACG265260
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG12022-ACR265260
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG12022-ANG265260
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG12022-ANR265260
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG12022-CF229890
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, C-His 태그HG12022-CH253470
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG12022-CM253470
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, C-HA 태그HG12022-CY253470
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone in cloning vectorHG12022-G88420
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG12022-NF229890
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, N-His 태그HG12022-NH229890
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG12022-NM229890
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, N-HA 태그HG12022-NY229890
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmidHG12022-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: HG12022-UT
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보In Stock
대량 주문 문의장바구니에 추가
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".