휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
휴먼 CYP2D6 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000106.4
cDNA 크기:1494bp
cDNA 설명:Full length Clone DNA of Homo sapiens cytochrome P450, family 2, subfamily D, polypeptide 6.
유전자 동의어:CPD6, CYP2D, CYP2DL1, CYPIID6, P450C2D, P450DB1, CYP2D7AP, CYP2D7BP, CYP2D7P2, CYP2D8P2, P450-DB1, MGC120389, MGC120390, CYP2D6
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-CYP2D6
제한 사이트:KpnI + XbaI (6.1kb + 1.49kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CYP2D6 qPCR primers for gene expression analysis, HP101558 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid on other vectors
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG12022-ACG265260
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG12022-ACR265260
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG12022-ANG265260
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG12022-ANR265260
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG12022-CF229890
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, C-His 태그HG12022-CH253470
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG12022-CM253470
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, C-HA 태그HG12022-CY253470
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone in cloning vectorHG12022-G88420
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG12022-NF229890
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, N-His 태그HG12022-NH229890
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG12022-NM229890
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmid, N-HA 태그HG12022-NY229890
휴먼 CYP2D6/Cytochrome P450 2D6 Gene ORF cDNA clone expression plasmidHG12022-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: HG12022-UT
정가: 
가격:      (You Save: )
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".