휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
휴먼 CYP3A4 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_017460.3
cDNA 크기:1512bp
cDNA 설명:Full length Clone DNA of Homo sapiens cytochrome P450, family 3, subfamily A, polypeptide 4 with C terminal His tag.
유전자 동의어:HLP, CP33, CP34, CYP3A, NF-25, CYP3A3, P450C3, P450PCN1, MGC126680, CYP3A4
:Human
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CYP3A4 qPCR primers for gene expression analysis, HP101577 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone expression plasmid, C-His 태그 on other vectors
휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG12043-ACG288840
휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG12043-ACR288840
휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG12043-ANG288840
휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG12043-ANR288840
휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG12043-CF253470
휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone expression plasmid, C-His 태그HG12043-CH253470
휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG12043-CM253470
휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone expression plasmid, C-HA 태그HG12043-CY253470
휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone in cloning vectorHG12043-G88420
휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG12043-NF253470
휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone expression plasmid, N-His 태그HG12043-NH253470
휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG12043-NM253470
휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone expression plasmid, N-HA 태그HG12043-NY253470
휴먼 CYP3A4/Cytochrome P450 3A4 Gene ORF cDNA clone expression plasmidHG12043-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
Size / Price
Cat No: HG12043-CH
정가: 
가격:      (You Save: )
Contact Us
이미지
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".