After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human CAMK4 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001744.4
cDNA 크기:1422bp
cDNA 설명:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase IV.
유전자 동의어:CaMK-GR, MGC36771, CAMK4
:Human
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid on other vectors
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10664-ACG265260
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10664-ACR265260
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG10664-ANG265260
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG10664-ANR265260
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10664-CF229890
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid, C-His 태그HG10664-CH229890
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10664-CM229890
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid, C-HA 태그HG10664-CY229890
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone in cloning vectorHG10664-M88420
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10664-M-F229890
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmidHG10664-M-N229890
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10664-NF229890
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid, N-His 태그HG10664-NH229890
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10664-NM229890
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmid, N-HA 태그HG10664-NY229890
휴먼 CaM Kinase 4/CaMKIV Gene ORF cDNA clone expression plasmidHG10664-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) belongs to the serine/threonine protein kinase family, and to the Ca2+/calmodulin-dependent protein kinase subfamily which is widely recognized as an essential enzyme implicated in the phophoinositide amplification cascade. Ca2+/calmodulin dependent protein kinase (CAMK) can be activated by the introcellular increased Ca2+ and then apt to combine with the target protein. Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) is a multifunctional CaM-dependent kinase protein with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. All of the isforms of this family, including myosin light chain kinase, phosphorylase kinase, CaMK1, CaMKⅢ and CaMKⅣ have EF-hand structure.

참고자료
  • Feliciano DM, et al. (2009) Repression of Ca2+/calmodulin-dependent protein kinase IV signaling accelerates retinoic acid-induced differentiation of human neuroblastoma cells. J Biol Chem. 284 (39): 26466-81.
  • Zhao X, et al. (2001). The modular nature of histone deacetylase HDAC4 confers phosphorylation-dependent intracellular trafficking. J Biol Chem. 276 (37): 35042-8.
  • Racioppi L, et al. (2008) Calcium/calmodulin-dependent kinase IV in immune and inflammatory responses: novel routes for an ancient traveller.
  • Size / Price
    Cat No: HG10664-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".