After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Carboxypeptidase M/CPM Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Human CPM cDNA 클론 제품 정보
Gene_bank_ref_id:NM_198320.3
cDNA 크기:1332bp
cDNA 설명:Full length Clone DNA of Homo sapiens carboxypeptidase M with N terminal Flag tag.
유전자 동의어:CPM
:Human
벡터:pCMV3-SP-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Carboxypeptidase M, also known as CPM, is a membrane-bound arginine/lysine carboxypeptidase which is a member of the carboxypeptidases family. These enzymes remove C-terminal amino acids from peptides and proteins and exert roles in the physiological processes of blood coagulation/fibrinolysis, inflammation, food digestion and pro-hormone and neuropeptide processing. Among the carboxypeptidases CPM is of particular importance because of its constitutive expression in an active form at the surface of specialized cells and tissues in the human body. CPM in the brain appears to be membrane-bound via a phosphatidylinositol glycan anchor. CPM is widely distributed in a variety of tissues and cells. The amino acid sequence of CPM indicated that the C-terminal hydrophobic region might be a signal for membrane attachment via a glycosylphosphatidylinositol (GPI) anchor. CPM is involved in peptide metabolism on both the cell surface and in extracellular fluids. CPM functions not only as a protease but also as a binding partner in cell-surface protein-protein interactions.

참고자료
  • Deddish PA. et al., 1990, J Biol Chem. 265 (25): 15083-9.
  • Nagae A. et al., 1992, J Neurochem. 59 (6): 2201-12.
  • Skidgel RA. et al., 1996, Immunopharmacology. 32 (1-3): 48-52.
  • Deiteren K. et al., 2009, Clin Chim Acta. 399 (1-2): 24-39.
  • Size / Price
    Cat No: HG11228-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".