After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
Human DBH cDNA 클론 제품 정보
Gene_bank_ref_id:BC017174
cDNA 크기:1812bp
cDNA 설명:Full length Clone DNA of Homo sapiens dopamine beta-hydroxylase (dopamine beta-monooxyge) with N terminal HA tag.
유전자 동의어:DBM, DBH
:Human
벡터:pCMV3-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-HA 태그 on other vectors
휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG13440-ACG288840
휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG13440-ACR288840
휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG13440-ANG288840
휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG13440-ANR288840
휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, C-Flag 태그HG13440-CF253472
휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, C-His 태그HG13440-CH253472
휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, C-Myc 태그HG13440-CM253472
휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, C-HA 태그HG13440-CY253472
휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone in cloning vectorHG13440-G88421
휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-Flag 태그HG13440-NF253472
휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-His 태그HG13440-NH253472
휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-Myc 태그HG13440-NM253472
휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-HA 태그HG13440-NY253472
휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmidHG13440-UT253472
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

DBH is a 290 kDa copper-containing oxygenase. It can be detected in noradrenergic nerve terminals of the central and peripheral nervous systems, and is also expressed in chromaffin cells of the adrenal medulla. DBH contains our identical subunits, and its activity requires ascorbate as a cofactor. It functions in in the synthesis of small-molecule neurotransmitters that is membrane-bound, making norepinephrine the only transmitter synthesized inside vesicles. DBH has been shown to be associated with decision making and addictive behaviors such as alcohol and smoking, attention deficit hyperactivity disorder, and also with neurological diseases such as Schizophrenia and Alzheimer's.

참고자료
  • Rush RA. et al., 1980, Crit Rev Clin Lab Sci. 12 (3): 241-77.
  • Goldstein M. et al., 1964, Life Sci. 3 (7): 763-7.
  • S Friedman. et al., 1966, The Journal of Biological Chemistry. 241 (10): 2256-9.
  • Size / Price
    Cat No: HG13440-NY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".