휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-HA 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 DBH cDNA 클론 제품 정보
    Gene_bank_ref_id:BC017174
    cDNA 크기:1812bp
    cDNA 설명:Full length Clone DNA of Homo sapiens dopamine beta-hydroxylase (dopamine beta-monooxyge) with N terminal HA tag.
    유전자 동의어:DBM, DBH
    :Human
    벡터:pCMV3-N-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DBH qPCR primers for gene expression analysis, HP102142 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-HA 태그 on other vectors
    휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG13440-ACG288840
    휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG13440-ACR288840
    휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG13440-ANG288840
    휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG13440-ANR288840
    휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, C-Flag 태그HG13440-CF253470
    휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, C-His 태그HG13440-CH253470
    휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, C-Myc 태그HG13440-CM253470
    휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, C-HA 태그HG13440-CY253470
    휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone in cloning vectorHG13440-G88420
    휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-Flag 태그HG13440-NF253470
    휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-His 태그HG13440-NH253470
    휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-Myc 태그HG13440-NM253470
    휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmid, N-HA 태그HG13440-NY253470
    휴먼 DBH / Dopamine beta-Hydroxylase Gene ORF cDNA clone expression plasmidHG13440-UT253470
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    연구배경

    DBH is a 290 kDa copper-containing oxygenase. It can be detected in noradrenergic nerve terminals of the central and peripheral nervous systems, and is also expressed in chromaffin cells of the adrenal medulla. DBH contains our identical subunits, and its activity requires ascorbate as a cofactor. It functions in in the synthesis of small-molecule neurotransmitters that is membrane-bound, making norepinephrine the only transmitter synthesized inside vesicles. DBH has been shown to be associated with decision making and addictive behaviors such as alcohol and smoking, attention deficit hyperactivity disorder, and also with neurological diseases such as Schizophrenia and Alzheimer's.

    참고자료
  • Rush RA. et al., 1980, Crit Rev Clin Lab Sci. 12 (3): 241-77.
  • Goldstein M. et al., 1964, Life Sci. 3 (7): 763-7.
  • S Friedman. et al., 1966, The Journal of Biological Chemistry. 241 (10): 2256-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".