After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Human DDC cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000790.3
cDNA 크기:1443bp
cDNA 설명:Full length Clone DNA of Homo sapiens dopa decarboxylase (aromatic L-amino acid decarboxylase) with N terminal Flag tag.
유전자 동의어:AADC
:Human
벡터:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-DDC
제한 사이트:HindIII + XbaI (6kb + 1.48kb)
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human DDC Gene Plasmid Map
Human DDC natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmid, N-Flag 태그 on other vectors
휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10560-ACG265260
휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10560-ACR265260
휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG10560-ANG265260
휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG10560-ANR265260
휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10560-CF229890
휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmid, C-His 태그HG10560-CH229890
휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10560-CM229890
휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmid, C-HA 태그HG10560-CY229890
휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone in cloning vectorHG10560-M88420
휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmidHG10560-M-N229890
휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10560-NF229890
휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmid, N-His 태그HG10560-NH229890
휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10560-NM229890
휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmid, N-HA 태그HG10560-NY229890
휴먼 DOPA Decarboxylase/DDC Gene ORF cDNA clone expression plasmidHG10560-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Dopa Decarboxylase (DDC), also known as AADC and Aromatic-L-amino acid decarboxylase, is a 54 kDa member of the group II decarboxylase family of proteins.It is a vitamin B6-dependent homodimeric enzyme that catalyzes the decarboxylation of both L-3,4-dihydroxyphenylalanine (L-DOPA) and L-5-hydroxytryptophan to dopamine and serotonin, respectively, which are major mammalian neurotransmitters and hormones belonging to catecholamines and indoleamines. Since L-DOPA is regularly used to treat the symptoms of Parkinson's disease, the catalytic pathway is of particular research interest. Defects of DDC are associated with severe developmental delay, oculogyric crises (OGC), as well as autosomal recessive disorder AADC deficiency, an early onset inborn error in neurotransmitter metabolism which can lead to catecholamine and serotonin deficiency.

참고자료
  • Ichinose, H. et al.,1989,Biochem. Biophys. Res. Commun. 164: 1024-1030.
  • Lisa, J. S. et al., 1992, Genomics 13: 469-471.
  • Moore, P. S. et al.,1996, Biochem. J. 315:249-256.
  • Bertoldi, M. et al., 2003, Biochim. Biophys. Acta. 1647:42-47.
  • Vassilacopoulou, D. et al., 2004, Neurochem. Res. 29: 1817-1823.
  • Ma, J.Z., et al., 2005, Hum. Mol. Genet. 14: 1691-1698.
  • Size / Price
    Cat No: HG10560-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human DDC natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".