DNMT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG11224-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All DNMT2 Reagents

CRO Services

Product recommended


All DNMT2 Reagents

DNMT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1176 bp
Description
Full length Clone DNA of Human tRNA aspartic acid methyltransferase 1 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DNMT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

DMNT2 cDNA ORF Clone, Human;DNMT2 cDNA ORF Clone, Human;MHSAIIP cDNA ORF Clone, Human;PUMET cDNA ORF Clone, Human;RNMT1 cDNA ORF Clone, Human

DNMT2 Background Information

DNMT2, also known as tRNA (cytosine-5-)-methyltransferase, DNA methyltransferase homolog HsaIIP, and TRDMT1, is a member of the DNA methyltransferase family of enzymes. DNMT2 enzymes have been widely conserved during evolution and contain all of the signature motifs of DNA (cytosine-5)-methyltransferases. It contains all 10 sequence motifs that are conserved among m(5)C MTases, including the consensus S:-adenosyl-L-methionine-binding motifs and the active site ProCys dipeptide, and its structure is very similar to prokaryotic DNA methyltransferases. DNMT2 has close homologs in plants, insects and Schizosaccharomyces pombe, but no related sequence can be found in the genomes of Saccharomyces cerevisiae or Caenorhabditis elegans. While the biological function of DNMT2 is not yet known, the strong binding to DNA suggests that DNMT2 may mark specific sequences in the genome by binding to DNA through the specific target-recognizing motif. However, the DNA methyltransferase activity of these proteins is comparatively weak and their biochemical and functional properties remain enigmatic. Recent evidence now shows that Dnmt2 has a novel tRNA methyltransferase activity, raising the possibility that the biological roles of these proteins might be broader than previously thought.

Full Name
tRNA aspartic acid methyltransferase 1
References
  • Dong A, et al. (2001) Structure of human DNMT2, an enigmatic DNA methyltransferase homolog that displays denaturant-resistant binding to DNA. Nucleic Acids Res. 29(2): 439-48.
  • Hermann A, et al. (2003) The human Dnmt2 has residual DNA-(cytosine-C5) methyltransferase activity. J Biol Chem. 278(34): 31717-21.
  • Jeltsch A, et al. (2006) Two substrates are better than one: dual specificities for Dnmt2 methyltransferases. Trends Biochem Sci. 31(6): 306-8.
  • Schaefer M, et al. (2010) Solving the Dnmt2 enigma. Chromosoma. 119(1): 35-40.
  • info info
    添加购物车成功! 添加购物车失败!