After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 DPP7 / DPPII / DPP2 Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human DPP7 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_013379.2
cDNA 크기:1479bp
cDNA 설명:Full length Clone DNA of Homo sapiens dipeptidyl-peptidase 7 with N terminal His tag.
유전자 동의어:QPP, DPP2, DPPII, DPP7
:Human
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

DPP7 (dipeptidylpeptidase 7), also known as DPPII and DPP2, is a post-proline cleaving aminopeptidase expressed in quiescent lymphocytes. Dipeptidyl peptidases (DPPs) have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. DPPs mediate regulatory activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. DPPs can bind specific voltage-gated potassium channels and alter their expression and biophysical properties and may also influence T cells. DPP proteins include DPRP1, DPRP2, DPP3, DPP7, DPP10, DPPX and CD26. It localizes to lysosomes. DPP7 localizes to lysosomes and exists as a homodimer via its leucine zipper motif and is involved in the degradation of oligopeptides. In response to calcium release, it can be secreted in its active form. It is essential for lymphocyte survival, as the inhibition of DPP7 results in quiescent cell apoptosis.

참고자료
  • Chiravuri M, et al. (1999) A novel apoptotic pathway in quiescent lymphocytes identified by inhibition of a post-proline cleaving aminodipeptidase: a candidate target protease, quiescent cell proline dipeptidase. J Immunol. 163(6):3092-9.
  • Fukasawa KM, et al. (2001) Cloning and functional expression of rat kidney dipeptidyl peptidase II. Biochem J. 353(Pt 2):283-90.
  • Fornas E, et al. (1992) Effect of cholesterol and its autooxidation derivatives on endocytosis and dipeptidyl peptidases of aortic endothelial cells. Histol Histopathol. 7(2):163-8.
  • Size / Price
    Cat No: HG10748-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".