DTYMK cDNA ORF Clone, Human, untagged

Cat: HG14233-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All DTYMK Reagents

CRO Services

Product recommended


All DTYMK Reagents

DTYMK cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
639 bp
Description
Full length Clone DNA of Human deoxythymidylate kinase (thymidylate kinase).

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DTYMK cDNA ORF Clone, Human, untagged Alternative Names

CDC8 cDNA ORF Clone, Human;PP3731 cDNA ORF Clone, Human;TMPK cDNA ORF Clone, Human;TYMK cDNA ORF Clone, Human

DTYMK Background Information

Full Name
deoxythymidylate kinase

DTYMK cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DTYMK cDNA ORF Clone in Cloning Vector, Rat RG84061-U
DTYMK Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84061-ACGLN

DTYMK cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DTYMK cDNA ORF Clone in Cloning Vector, Mouse MG5A4626-U
DTYMK cDNA ORF Clone, Mouse, untagged MG5A4626-UT
DTYMK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4626-ACG
DTYMK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4626-ACGLN
DTYMK cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4626-ANG
DTYMK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4626-ACR
DTYMK cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4626-ANR
DTYMK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4626-CF
DTYMK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4626-NF
DTYMK cDNA ORF Clone, Mouse, C-His tag MG5A4626-CH
DTYMK cDNA ORF Clone, Mouse, N-His tag MG5A4626-NH
DTYMK cDNA ORF Clone, Mouse, C-HA tag MG5A4626-CY
DTYMK cDNA ORF Clone, Mouse, N-HA tag MG5A4626-NY
DTYMK cDNA ORF Clone, Mouse, C-Myc tag MG5A4626-CM
DTYMK cDNA ORF Clone, Mouse, N-Myc tag MG5A4626-NM

DTYMK cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DTYMK cDNA ORF Clone in Cloning Vector, Human HG14233-G
DTYMK cDNA ORF Clone, Human, C-GFPSpark® tag HG14233-ACG
DTYMK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14233-ACGLN
DTYMK cDNA ORF Clone, Human, N-GFPSpark® tag HG14233-ANG
DTYMK cDNA ORF Clone, Human, C-OFPSpark® tag HG14233-ACR
DTYMK cDNA ORF Clone, Human, N-OFPSpark® tag HG14233-ANR
DTYMK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14233-CF
DTYMK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14233-NF
DTYMK cDNA ORF Clone, Human, C-His tag HG14233-CH
DTYMK cDNA ORF Clone, Human, N-His tag HG14233-NH
DTYMK cDNA ORF Clone, Human, C-HA tag HG14233-CY
DTYMK cDNA ORF Clone, Human, N-HA tag HG14233-NY
DTYMK cDNA ORF Clone, Human, C-Myc tag HG14233-CM
DTYMK cDNA ORF Clone, Human, N-Myc tag HG14233-NM
DTYMK qPCR Primer Pairs, Human HP102883
info info
添加购物车成功! 添加购物车失败!