휴먼 RCAS1 / EBAG9 Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Human EBAG9 cDNA 클론 제품 정보
Gene_bank_ref_id:BC017729
cDNA 크기:642bp
cDNA 설명:Full length Clone DNA of Homo sapiens estrogen receptor binding site associated, antigen, 9 with C terminal His tag.
유전자 동의어:EB9, PDAF, RCAS1, EBAG9
:Human
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
연구배경

RCAS1, also known as EBAG9, is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. RCAS1 gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor which binds to the estrogen-responsive element (ERE) found in the 5'-flanking region of RCAS1 gene. Two transcript variants differing in the 5' UTR, but encoding the same protein, have been identified for RCAS1 gene. EBAG9 may participate in suppression of cell proliferation and induces apoptotic cell death through activation of interleukin-1-beta converting enzyme (ICE)-like proteases.

참고자료
  • Ohshima K. et al., 2001, Clin Exp Immunol. 123 (3): 481-6.
  • Ikeda K. et al., 2000, Biochem Biophys Res Commun. 273 (2): 654-60.
  • Nakashima M. et al., 1999, Nat Med. 5 (8): 938-42.
  • Size / Price
    Cat No: HG14012-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".