EHHADH cDNA ORF Clone, Human, N-HA tag

Cat: HG15787-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All EHHADH Reagents

CRO Services

Product recommended


All EHHADH Reagents

EHHADH cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2172 bp
Description
Full length Clone DNA of Human enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EHHADH cDNA ORF Clone, Human, N-HA tag Alternative Names

ECHD cDNA ORF Clone, Human;FRTS3 cDNA ORF Clone, Human;L-PBE cDNA ORF Clone, Human;LBFP cDNA ORF Clone, Human;LBP cDNA ORF Clone, Human;PBFE cDNA ORF Clone, Human

EHHADH Background Information

Full Name
enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase

EHHADH cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EHHADH cDNA ORF Clone in Cloning Vector, Mouse MG5A0760-U
EHHADH cDNA ORF Clone, Mouse, untagged MG5A0760-UT
EHHADH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0760-ACGLN
EHHADH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0760-ACG
EHHADH cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0760-ANG
EHHADH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0760-ACR
EHHADH cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0760-ANR
EHHADH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0760-CF
EHHADH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0760-NF
EHHADH cDNA ORF Clone, Mouse, C-His tag MG5A0760-CH
EHHADH cDNA ORF Clone, Mouse, N-His tag MG5A0760-NH
EHHADH cDNA ORF Clone, Mouse, C-HA tag MG5A0760-CY
EHHADH cDNA ORF Clone, Mouse, N-HA tag MG5A0760-NY
EHHADH cDNA ORF Clone, Mouse, C-Myc tag MG5A0760-CM
EHHADH cDNA ORF Clone, Mouse, N-Myc tag MG5A0760-NM

EHHADH cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EHHADH cDNA ORF Clone in Cloning Vector, Human HG15787-G
EHHADH cDNA ORF Clone, Human, untagged HG15787-UT
EHHADH Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15787-ACGLN
EHHADH cDNA ORF Clone, Human, C-GFPSpark® tag HG15787-ACG
EHHADH cDNA ORF Clone, Human, N-GFPSpark® tag HG15787-ANG
EHHADH cDNA ORF Clone, Human, C-OFPSpark® tag HG15787-ACR
EHHADH cDNA ORF Clone, Human, N-OFPSpark® tag HG15787-ANR
EHHADH cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15787-CF
EHHADH cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15787-NF
EHHADH cDNA ORF Clone, Human, C-His tag HG15787-CH
EHHADH cDNA ORF Clone, Human, N-His tag HG15787-NH
EHHADH cDNA ORF Clone, Human, C-HA tag HG15787-CY
EHHADH cDNA ORF Clone, Human, C-Myc tag HG15787-CM
EHHADH cDNA ORF Clone, Human, N-Myc tag HG15787-NM
EHHADH qPCR Primer Pairs, Human HP104378
info info
添加购物车成功! 添加购物车失败!