EIF3D cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16281-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All EIF3D Reagents

CRO Services

Product recommended


All EIF3D Reagents

EIF3D cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1647 bp
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 3, subunit D with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF3D cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

eIF3-p66 cDNA ORF Clone, Human;eIF3-zeta cDNA ORF Clone, Human;EIF3S7 cDNA ORF Clone, Human

EIF3D Background Information

Full Name
eukaryotic translation initiation factor 3, subunit D

EIF3D cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EIF3D cDNA ORF Clone in Cloning Vector, Mouse MG51219-U
EIF3D cDNA ORF Clone, Mouse, untagged MG51219-UT
EIF3D Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51219-ACGLN
EIF3D cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51219-ACG
EIF3D cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51219-ANG
EIF3D cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51219-ACR
EIF3D cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51219-ANR
EIF3D cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51219-CF
EIF3D cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51219-NF
EIF3D cDNA ORF Clone, Mouse, C-His tag MG51219-CH
EIF3D cDNA ORF Clone, Mouse, N-His tag MG51219-NH
EIF3D cDNA ORF Clone, Mouse, C-HA tag MG51219-CY
EIF3D cDNA ORF Clone, Mouse, N-HA tag MG51219-NY
EIF3D cDNA ORF Clone, Mouse, C-Myc tag MG51219-CM
EIF3D cDNA ORF Clone, Mouse, N-Myc tag MG51219-NM
EIF3D qPCR Primer Pairs, Mouse MP201103

EIF3D cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF3D cDNA ORF Clone in Cloning Vector, Human HG16281-G
EIF3D cDNA ORF Clone, Human, untagged HG16281-UT
EIF3D cDNA ORF Clone, Human, C-GFPSpark® tag HG16281-ACG
EIF3D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16281-ACGLN
EIF3D cDNA ORF Clone, Human, N-GFPSpark® tag HG16281-ANG
EIF3D cDNA ORF Clone, Human, C-OFPSpark® tag HG16281-ACR
EIF3D cDNA ORF Clone, Human, N-OFPSpark® tag HG16281-ANR
EIF3D cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16281-NF
EIF3D cDNA ORF Clone, Human, C-His tag HG16281-CH
EIF3D cDNA ORF Clone, Human, N-His tag HG16281-NH
EIF3D cDNA ORF Clone, Human, C-HA tag HG16281-CY
EIF3D cDNA ORF Clone, Human, N-HA tag HG16281-NY
EIF3D cDNA ORF Clone, Human, C-Myc tag HG16281-CM
EIF3D cDNA ORF Clone, Human, N-Myc tag HG16281-NM
EIF3D qPCR Primer Pairs, Human HP105035
info info
添加购物车成功! 添加购物车失败!