ELK3 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG14450-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ELK3 Reagents
CRO Services
Product recommended

All ELK3 Reagents
ELK3 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1224 bp
Description
Full length Clone DNA of Human ELK3, ETS-domain protein (SRF accessory protein 2) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ELK3 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ERP cDNA ORF Clone, Human;NET cDNA ORF Clone, Human;SAP-2 cDNA ORF Clone, Human;SAP2 cDNA ORF Clone, Human
ELK3 Background Information
Full Name
ELK3, ETS-domain protein (SRF accessory protein 2)

ELK3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ELK3 cDNA ORF Clone in Cloning Vector, Mouse MG53214-G
ELK3 cDNA ORF Clone, Mouse, untagged MG53214-UT
ELK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53214-ACGLN
ELK3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53214-ACG
ELK3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53214-ANG
ELK3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53214-ACR
ELK3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53214-ANR
ELK3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53214-CF
ELK3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53214-NF
ELK3 cDNA ORF Clone, Mouse, C-His tag MG53214-CH
ELK3 cDNA ORF Clone, Mouse, N-His tag MG53214-NH
ELK3 cDNA ORF Clone, Mouse, C-HA tag MG53214-CY
ELK3 cDNA ORF Clone, Mouse, N-HA tag MG53214-NY
ELK3 cDNA ORF Clone, Mouse, C-Myc tag MG53214-CM
ELK3 cDNA ORF Clone, Mouse, N-Myc tag MG53214-NM

ELK3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ELK3 cDNA ORF Clone in Cloning Vector, Human HG14450-G
ELK3 cDNA ORF Clone, Human, untagged HG14450-UT
ELK3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14450-ACG
ELK3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14450-ACGLN
ELK3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14450-ANG
ELK3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14450-ACR
ELK3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14450-ANR
ELK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14450-NF
ELK3 cDNA ORF Clone, Human, C-His tag HG14450-CH
ELK3 cDNA ORF Clone, Human, N-His tag HG14450-NH
ELK3 cDNA ORF Clone, Human, C-HA tag HG14450-CY
ELK3 cDNA ORF Clone, Human, N-HA tag HG14450-NY
ELK3 cDNA ORF Clone, Human, C-Myc tag HG14450-CM
ELK3 cDNA ORF Clone, Human, N-Myc tag HG14450-NM
ELK3 qPCR Primer Pairs, Human HP103098
info info
添加购物车成功! 添加购物车失败!