After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 ENO3 / beta-enolase Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human ENO3 cDNA 클론 제품 정보
Gene_bank_ref_id:BC017249
cDNA 크기:1305bp
cDNA 설명:Full length Clone DNA of Homo sapiens enolase 3 (beta, muscle).
유전자 동의어:GSD13, MSE, ENO3
:Human
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
연구배경

ENO3 is one of the three enolase isoenzymes found in mammals. As a homodimer, ENO3 is found in skeletal muscle cells in the adult. A switch from alpha enolase to beta enolase occurs in muscle tissue during development in rodents. Mutations in ENO3 gene can be associated with metabolic myopathies that may result from decreased stability of the enzyme. Two transcripts have been identified for ENO3 gene that differ only in their 5' UTR. ENO3 may play a role in muscle development and regeneration. It appears to have a function in striated muscle development and regeneration.

참고자료
  • Peshavaria M, et al. (1989) Structure of human muscle (beta) enolase mRNA and protein deduced from a genomic clone. Nucleic Acids Res. 17(21):8862.
  • Calì L, et al. (1990) Nucleotide sequence of a cDNA encoding the human muscle-specific enolase (MSE). Nucleic Acids Res. 18(7):1893.
  • Peshavaria M, et al. (1991) Molecular structure of the human muscle-specific enolase gene (ENO3). Biochem J. 275(2):427-33.
  • Size / Price
    Cat No: HG14270-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".