ENO3 cDNA ORF Clone, Human, untagged

Cat: HG14270-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ENO3 Reagents
CRO Services
Product recommended

All ENO3 Reagents
ENO3 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1305 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human enolase 3 (beta, muscle).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI(6.1kb+1.31kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ENO3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ENO3 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
ENO3 cDNA ORF Clone, Human, untagged Alternative Names
GSD13 cDNA ORF Clone, Human;MSE cDNA ORF Clone, Human
ENO3 Background Information

ENO3 is one of the three enolase isoenzymes found in mammals. As a homodimer, ENO3 is found in skeletal muscle cells in the adult. A switch from alpha enolase to beta enolase occurs in muscle tissue during development in rodents. Mutations in ENO3 gene can be associated with metabolic myopathies that may result from decreased stability of the enzyme. Two transcripts have been identified for ENO3 gene that differ only in their 5' UTR. ENO3 may play a role in muscle development and regeneration. It appears to have a function in striated muscle development and regeneration.

Full Name
enolase 3 (beta, muscle)
References
  • Peshavaria M, et al. (1989) Structure of human muscle (beta) enolase mRNA and protein deduced from a genomic clone. Nucleic Acids Res. 17(21):8862.
  • Calì L, et al. (1990) Nucleotide sequence of a cDNA encoding the human muscle-specific enolase (MSE). Nucleic Acids Res. 18(7):1893.
  • Peshavaria M, et al. (1991) Molecular structure of the human muscle-specific enolase gene (ENO3). Biochem J. 275(2):427-33.
  • ENO3 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ENO3 cDNA ORF Clone in Cloning Vector, Rat RG80689-U
    ENO3 cDNA ORF Clone, Rat, untagged RG80689-UT
    ENO3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80689-ACG
    ENO3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80689-ACGLN
    ENO3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80689-ANG
    ENO3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80689-ACR
    ENO3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80689-ANR
    ENO3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80689-CF
    ENO3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80689-NF
    ENO3 cDNA ORF Clone, Rat, C-His tag RG80689-CH
    ENO3 cDNA ORF Clone, Rat, N-His tag RG80689-NH
    ENO3 cDNA ORF Clone, Rat, C-HA tag RG80689-CY
    ENO3 cDNA ORF Clone, Rat, N-HA tag RG80689-NY
    ENO3 cDNA ORF Clone, Rat, C-Myc tag RG80689-CM
    ENO3 cDNA ORF Clone, Rat, N-Myc tag RG80689-NM
    ENO3 qPCR Primer Pairs, Rat RP300653

    ENO3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ENO3 cDNA ORF Clone in Cloning Vector, Mouse MG52862-G
    ENO3 cDNA ORF Clone, Mouse, untagged MG52862-UT
    ENO3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52862-ACGLN
    ENO3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52862-ACG
    ENO3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52862-ACR
    ENO3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52862-CF
    ENO3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52862-NF
    ENO3 cDNA ORF Clone, Mouse, C-His tag MG52862-CH
    ENO3 cDNA ORF Clone, Mouse, N-His tag MG52862-NH
    ENO3 cDNA ORF Clone, Mouse, C-HA tag MG52862-CY
    ENO3 cDNA ORF Clone, Mouse, N-HA tag MG52862-NY
    ENO3 cDNA ORF Clone, Mouse, C-Myc tag MG52862-CM
    ENO3 cDNA ORF Clone, Mouse, N-Myc tag MG52862-NM

    ENO3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ENO3 cDNA ORF Clone in Cloning Vector, Human HG14270-G
    ENO3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14270-ACGLN
    ENO3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14270-ACG
    ENO3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14270-ANG
    ENO3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14270-ACR
    ENO3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14270-ANR
    ENO3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14270-CF
    ENO3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14270-NF
    ENO3 cDNA ORF Clone, Human, C-His tag HG14270-CH
    ENO3 cDNA ORF Clone, Human, N-His tag HG14270-NH
    ENO3 cDNA ORF Clone, Human, C-HA tag HG14270-CY
    ENO3 cDNA ORF Clone, Human, N-HA tag HG14270-NY
    ENO3 cDNA ORF Clone, Human, C-Myc tag HG14270-CM
    ENO3 cDNA ORF Clone, Human, N-Myc tag HG14270-NM
    ENO3 qPCR Primer Pairs, Human HP102920
    info info
    添加购物车成功! 添加购物车失败!