After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 ENTPD5 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human ENTPD5 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001249.2
cDNA 크기:1287bp
cDNA 설명:Full length Clone DNA of Homo sapiens ectonucleoside triphosphate diphosphohydrolase 5.
유전자 동의어:PCPH, CD39L4, MGC163357, MGC163359, NTPDase-5, ENTPD5
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-ENTPD5
제한 사이트:HindIII + NotI (6.1kb + 1.29kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human ENTPD5 Gene Plasmid Map
Human ENTPD5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
연구배경

Ectonucleoside triphosphate diphosphohydrolase 5 (ENTPD5), also known as CD39 antigen-like 4, ER-UDPase, Guanosine-diphosphatase ENTPD5, Nucleoside diphosphatase Uridine-diphosphatase ENTPD5. This hydrolase is expressed in response to phosphoinositide 3-kinase (PI3K) signaling. Activation of PI3K results in FOXO phosphorylation by AKT1 and loss of ENTPD5 transcriptional repression. It is Up-regulated in PTEN-deficient cells. Uridine diphosphatase (UDPase) that promotes protein N-glycosylation and ATP level regulation.ENTPD5 promotes protein N-glycosylation and folding in the endoplasmic reticulum, as well as elevated ATP consumption in the cytosol via an ATP hydrolysis cycle. Together with CMPK1 and AK1, ENTPD5 constitutes an ATP hydrolysis cycle that converts ATP to AMP and results in a compensatory increase in aerobic glycolysis. ENTPD5 also hydrolyzes GDP and IDP but not any other nucleoside di-, mono- or triphosphates, nor thiamine pyrophosphate. This enzyme Plays a key role in the AKT1-PTEN signaling pathway by promoting glycolysis in proliferating cells in response to phosphoinositide 3-kinase (PI3K) signaling.

참고자료
  • Villar J, et al. (2009) PCPH/ENTPD5 expression confers to prostate cancer cells resistance against cisplatin-induced apoptosis through protein kinase Calpha-mediated Bcl-2 stabilization. Cancer Res. 69(1): 102-10.
  • Fang M, et al. (2010) The ER UDPase ENTPD5 promotes protein N-glycosylation, the Warburg effect, and proliferation in the PTEN pathway. Cell. 143(5): 711-24.
  • Paez JG, et al. (2001) Identity between the PCPH proto-oncogene and the CD39L4 (ENTPD5) ectonucleoside triphosphate diphosphohydrolase gene. Int J Oncol. 19(6): 1249-54.
  • Size / Price
    Cat No: HG11184-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human ENTPD5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".