EPHX2 cDNA ORF Clone, Human, N-His tag

Cat: HG14856-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EPHX2 Reagents
CRO Services
Product recommended

All EPHX2 Reagents
EPHX2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1668 bp
Description
Full length Clone DNA of Human epoxide hydrolase 2, cytoplasmic with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EPHX2 cDNA ORF Clone, Human, N-His tag Alternative Names
CEH cDNA ORF Clone, Human;SEH cDNA ORF Clone, Human
EPHX2 Background Information
Full Name
epoxide hydrolase 2, cytoplasmic

EPHX2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EPHX2 cDNA ORF Clone in Cloning Vector, Mouse MG57673-U
EPHX2 cDNA ORF Clone, Mouse, untagged MG57673-UT
EPHX2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57673-ACGLN
EPHX2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57673-ACG
EPHX2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57673-ANG
EPHX2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57673-ACR
EPHX2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57673-ANR
EPHX2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57673-CF
EPHX2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57673-NF
EPHX2 cDNA ORF Clone, Mouse, C-His tag MG57673-CH
EPHX2 cDNA ORF Clone, Mouse, N-His tag MG57673-NH
EPHX2 cDNA ORF Clone, Mouse, C-HA tag MG57673-CY
EPHX2 cDNA ORF Clone, Mouse, N-HA tag MG57673-NY
EPHX2 cDNA ORF Clone, Mouse, C-Myc tag MG57673-CM
EPHX2 cDNA ORF Clone, Mouse, N-Myc tag MG57673-NM

EPHX2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EPHX2 cDNA ORF Clone in Cloning Vector, Human HG14856-G
EPHX2 cDNA ORF Clone, Human, untagged HG14856-UT
EPHX2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14856-ACGLN
EPHX2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14856-ACG
EPHX2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14856-ANG
EPHX2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14856-ACR
EPHX2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14856-ANR
EPHX2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14856-CF
EPHX2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14856-NF
EPHX2 cDNA ORF Clone, Human, C-His tag HG14856-CH
EPHX2 cDNA ORF Clone, Human, C-HA tag HG14856-CY
EPHX2 cDNA ORF Clone, Human, N-HA tag HG14856-NY
EPHX2 cDNA ORF Clone, Human, C-Myc tag HG14856-CM
EPHX2 cDNA ORF Clone, Human, N-Myc tag HG14856-NM
EPHX2 qPCR Primer Pairs, Human HP103487
info info
添加购物车成功! 添加购物车失败!