After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 EPOR/Erythropoietin Receptor transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Human EPOR cDNA 클론 제품 정보
Gene_bank_ref_id:NR_033663.1
cDNA 크기:1008bp
cDNA 설명:Full length Clone DNA of Homo sapiens erythropoietin receptor, transcript variant 2 with C terminal Flag tag.
유전자 동의어:EPO-R, MGC138358, EPOR
:Human
벡터:pCMV3-C-FLAG
Plasmid:pCMV3-EPOR-Flag
제한 사이트:KpnI + XbaI (6kb + 1.06kb)
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human EPOR Gene Plasmid Map
Human EPOR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
Human EPOR Gene Expression validated Image
Human EPOR transcript variant 2 ORF mammalian expression plasmid, C-Flag tag
[이미지를 확대하려면 클릭]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

휴먼 EPOR/Erythropoietin Receptor transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag 태그 on other vectors
휴먼 EPOR/Erythropoietin Receptor transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG13305-ACG265260
휴먼 EPOR/Erythropoietin Receptor transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG13305-ACR265260
휴먼 EPOR/Erythropoietin Receptor transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG13305-CF229890
휴먼 EPOR/Erythropoietin Receptor transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His 태그HG13305-CH229890
휴먼 EPOR/Erythropoietin Receptor transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG13305-CM229890
휴먼 EPOR/Erythropoietin Receptor transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA 태그HG13305-CY229890
휴먼 EPOR/Erythropoietin Receptor transcript variant 2 Gene ORF cDNA clone in cloning vectorHG13305-G88420
휴먼 EPOR/Erythropoietin Receptor transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG13305-NF229890
휴먼 EPOR/Erythropoietin Receptor transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His 태그HG13305-NH229890
휴먼 EPOR/Erythropoietin Receptor transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG13305-NM229890
휴먼 EPOR/Erythropoietin Receptor transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA 태그HG13305-NY229890
휴먼 EPOR/Erythropoietin Receptor transcript variant 2 Gene ORF cDNA clone expression plasmidHG13305-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Erythropoietin (EPO) is the major glycoprotein hormone regulator of mammalian erythropoiesis, and is produced by kidney and liver in an oxygen-dependent manner. The biological effects of EPO are mediated by the specific erythropoietin receptor (EPOR/EPO Receptor) on bone marrow erythroblasts, which transmits signals important for both proliferation and differentiation along the erythroid lineage. EPOR protein is a type â…  single-transmembrane cytokine receptor, and belongs to the homodimerizing subclass which functions as ligand-induced or ligand-stabilized homodimers. EPOR signaling prevents neuronal death and ischemic injury. Recent studies have shown that EPO and EPOR protein may be involved in carcinogenesis, angiogenesis, and invasion.

참고자료
  • Divoky V, et al. (2002) Mouse surviving solely on human erythropoietin receptor (EpoR): model of human EpoR-linked disease. Blood 99(10): 3873-4.
  • Carruthers SG. (2009) A truncated erythropoietin receptor EPOR-T is associated with hypertension susceptibility. Clin Pharmacol Ther. 86(2): 134-6.
  • Baltaziak M, et al. (2009) Relationships of P53 and Bak with EPO and EPOR in human colorectal cancer. Anticancer Res. 29(10):4151-6.
  • Size / Price
    Cat No: HG13305-CF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보In Stock
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
    • Human EPOR transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged
    • Human EPOR transcript variant 2 ORF mammalian expression plasmid, C-Flag tag
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".