ETFA cDNA ORF Clone, Human, N-HA tag

Cat: HG16404-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ETFA Reagents

CRO Services

Product recommended


All ETFA Reagents

ETFA cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1002 bp
Description
Full length Clone DNA of Human electron-transfer-flavoprotein, alpha polypeptide with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ETFA cDNA ORF Clone, Human, N-HA tag Alternative Names

EMA cDNA ORF Clone, Human;GA2 cDNA ORF Clone, Human;MADD cDNA ORF Clone, Human

ETFA Background Information

Full Name
electron-transfer-flavoprotein, alpha polypeptide

ETFA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ETFA cDNA ORF Clone in Cloning Vector, Rat RG85880-U
ETFA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85880-ACGLN

ETFA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ETFA cDNA ORF Clone in Cloning Vector, Mouse MG52439-G
ETFA cDNA ORF Clone, Mouse, untagged MG52439-UT
ETFA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52439-ACG
ETFA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52439-ACGLN
ETFA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52439-ANG
ETFA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52439-ACR
ETFA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52439-ANR
ETFA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52439-CF
ETFA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52439-NF
ETFA cDNA ORF Clone, Mouse, C-His tag MG52439-CH
ETFA cDNA ORF Clone, Mouse, N-His tag MG52439-NH
ETFA cDNA ORF Clone, Mouse, C-HA tag MG52439-CY
ETFA cDNA ORF Clone, Mouse, N-HA tag MG52439-NY
ETFA cDNA ORF Clone, Mouse, C-Myc tag MG52439-CM
ETFA cDNA ORF Clone, Mouse, N-Myc tag MG52439-NM
ETFA qPCR Primer Pairs, Mouse MP202312

ETFA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ETFA cDNA ORF Clone in Cloning Vector, Human HG16404-G
ETFA cDNA ORF Clone, Human, untagged HG16404-UT
ETFA cDNA ORF Clone, Human, C-GFPSpark® tag HG16404-ACG
ETFA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16404-ACGLN
ETFA cDNA ORF Clone, Human, N-GFPSpark® tag HG16404-ANG
ETFA cDNA ORF Clone, Human, C-OFPSpark® tag HG16404-ACR
ETFA cDNA ORF Clone, Human, N-OFPSpark® tag HG16404-ANR
ETFA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16404-CF
ETFA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16404-NF
ETFA cDNA ORF Clone, Human, C-His tag HG16404-CH
ETFA cDNA ORF Clone, Human, N-His tag HG16404-NH
ETFA cDNA ORF Clone, Human, C-HA tag HG16404-CY
ETFA cDNA ORF Clone, Human, C-Myc tag HG16404-CM
ETFA cDNA ORF Clone, Human, N-Myc tag HG16404-NM
ETFA qPCR Primer Pairs, Human HP105153
info info
添加购物车成功! 添加购物车失败!