휴먼 EZH2/KMT6 Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
    휴먼 EZH2 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_004456.3
    cDNA 크기:2256bp
    cDNA 설명:Full length Clone DNA of Homo sapiens enhancer of zeste homolog 2 (Drosophila).
    유전자 동의어:ENX1, EZH1, KMT6, ENX-1, KMT6A, MGC9169, EZH2
    :Human
    벡터:pCMV3-untagged
    Plasmid:pCMV3-EZH2
    제한 사이트:KpnI + NotI (6.1kb + 2.26kb)
    태그 씨퀀스:
    염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EZH2 qPCR primers for gene expression analysis, HP101222 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Size / Price
    Cat No: HG11337-UT
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".