FAM19A1 cDNA ORF Clone, Human, untagged

Cat: HG11182-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All FAM19A1 Reagents

CRO Services

Product recommended


All FAM19A1 Reagents

FAM19A1 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
402 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human family with sequence similarity 19 (chemokine (C-C motif)-like), member A1.

Plasmid

Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 0.4kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FAM19A1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM19A1 cDNA ORF Clone, Human, untagged Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5613

FAM19A1 cDNA ORF Clone, Human, untagged Alternative Names

TAFA-1 cDNA ORF Clone, Human;TAFA1 cDNA ORF Clone, Human

FAM19A1 Background Information

Full Name
family with sequence similarity 19 (chemokine (C-C motif)-like), member A1

FAM19A1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAM19A1 cDNA ORF Clone in Cloning Vector, Mouse MG50264-M
FAM19A1 cDNA ORF Clone, Mouse, untagged MG50264-UT
FAM19A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50264-ACG
FAM19A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50264-ACGLN
FAM19A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50264-ACR
FAM19A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50264-CF
FAM19A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50264-NF
FAM19A1 cDNA ORF Clone, Mouse, C-His tag MG50264-CH
FAM19A1 cDNA ORF Clone, Mouse, N-His tag MG50264-NH
FAM19A1 cDNA ORF Clone, Mouse, C-HA tag MG50264-CY
FAM19A1 cDNA ORF Clone, Mouse, N-HA tag MG50264-NY
FAM19A1 cDNA ORF Clone, Mouse, C-Myc tag MG50264-CM
FAM19A1 cDNA ORF Clone, Mouse, N-Myc tag MG50264-NM
FAM19A1 qPCR Primer Pairs, Mouse MP200289

FAM19A1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FAM19A1 cDNA ORF Clone in Cloning Vector, Human HG11182-M
FAM19A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11182-ACG
FAM19A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11182-ACGLN
FAM19A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11182-ACR
FAM19A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11182-CF
FAM19A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11182-NF
FAM19A1 cDNA ORF Clone, Human, C-His tag HG11182-CH
FAM19A1 cDNA ORF Clone, Human, N-His tag HG11182-NH
FAM19A1 cDNA ORF Clone, Human, C-HA tag HG11182-CY
FAM19A1 cDNA ORF Clone, Human, N-HA tag HG11182-NY
FAM19A1 cDNA ORF Clone, Human, C-Myc tag HG11182-CM
FAM19A1 cDNA ORF Clone, Human, N-Myc tag HG11182-NM
FAM19A1 qPCR Primer Pairs, Human HP101088
info info
添加购物车成功! 添加购物车失败!