After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 Fibroblast Activation 단백질 alpha/FAP Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Human FAP cDNA 클론 제품 정보
Gene_bank_ref_id:NM_004460.2
cDNA 크기:2283bp
cDNA 설명:Full length Clone DNA of Homo sapiens fibroblast activation protein, alpha with C terminal His tag.
유전자 동의어:FAPA, DPPIV, DKFZp686G13158, FAP
:Human
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

휴먼 Fibroblast Activation 단백질 alpha/FAP Gene ORF cDNA clone expression plasmid, C-His 태그 on other vectors
휴먼 Fibroblast Activation 단백질 alpha/FAP Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG10464-ACG288840
휴먼 Fibroblast Activation 단백질 alpha/FAP Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG10464-ACR288840
휴먼 Fibroblast Activation 단백질 alpha/FAP Gene ORF cDNA clone expression plasmid, C-Flag 태그HG10464-CF253470
휴먼 Fibroblast Activation 단백질 alpha/FAP Gene ORF cDNA clone expression plasmid, C-His 태그HG10464-CH253470
휴먼 Fibroblast Activation 단백질 alpha/FAP Gene ORF cDNA clone expression plasmid, C-Myc 태그HG10464-CM253470
휴먼 Fibroblast Activation 단백질 alpha/FAP Gene ORF cDNA clone expression plasmid, C-HA 태그HG10464-CY253470
휴먼 Fibroblast Activation 단백질 alpha/FAP Gene ORF cDNA clone in cloning vectorHG10464-M88420
휴먼 Fibroblast Activation 단백질 alpha/FAP Gene ORF cDNA clone expression plasmid, C-His 태그HG10464-M-H253470
휴먼 Fibroblast Activation 단백질 alpha/FAP Gene ORF cDNA clone expression plasmid, N-Flag 태그HG10464-NF253470
휴먼 Fibroblast Activation 단백질 alpha/FAP Gene ORF cDNA clone expression plasmid, N-His 태그HG10464-NH253470
휴먼 Fibroblast Activation 단백질 alpha/FAP Gene ORF cDNA clone expression plasmid, N-Myc 태그HG10464-NM253470
휴먼 Fibroblast Activation 단백질 alpha/FAP Gene ORF cDNA clone expression plasmid, N-HA 태그HG10464-NY253470
휴먼 Fibroblast Activation 단백질 alpha/FAP Gene ORF cDNA clone expression plasmidHG10464-UT253470
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Seprase, also known as 170 kDa melanoma membrane-bound gelatinase , Fibroblast activation protein alpha, Integral membrane serine protease and FAP, is a single-pass type II membrane protein which belongs to the peptidase S9B family. Seprase / FAP is found in cell surface lamellipodia, invadopodia and on shed vesicles. Seprase / FAP appears to act as a proteolytically active 170-kDa dimer, consisting of two 97-kDa subunits. It is a member of the group type II integral serine proteases, which includes dipeptidyl peptidase IV ( DPPIV / CD26 ) and related type II transmembrane prolyl serine peptidases, which exert their mechanisms of action on the cell surface. Seprase / FAP colocalized with DPP4 in invadopodia and lamellipodia of migratory activated endothelial cells in collagenous matrix. Seprase / FAP colocalized with DPP4 on endothelial cells of capillary-like microvessels but not large vessels within invasive breast ductal carcinoma. DPP4 and seprase exhibit multiple functions due to their abilities to form complexes with each other and to interact with other membrane-associated molecules. In association with DPP4, Seprase / FAP is involved in the pericellular proteolysis of the extracellular matrix (ECM), the migration and invasion of endothelial cells into the ECM. Seprase / FAP has a dual function in tumour progression. The proteolytic activity of Seprase has been shown to promote cell invasiveness towards the ECM and also to support tumour growth and proliferation. Seprase / FAP may have a role in tissue remodeling during development and wound healing, and may contribute to invasiveness in malignant cancers.

참고자료
  • Mori,Y. et al., 2004, Oncology. 67 (5-6):411-9.
  • Aertgeerts K., et al., 2005, J. Biol. Chem. 280:19441-19444.
  • Liu T., et al., 2005, J. Proteome Res. 4:2070-2080.
  • Ghersi G., et al., 2006, Cancer Res. 66:4652-4661.
  • O'Brien,P. et al., 2008, Biochim Biophys Acta. 1784 (9):1130-45.
  • Size / Price
    Cat No: HG10464-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".