Fibulin 5 cDNA ORF Clone, Human, N-HA tag

Cat: HG11176-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Fibulin 5 Reagents
CRO Services
Product recommended

All Fibulin 5 Reagents
Fibulin 5 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1347 bp
Description
Full length Clone DNA of Human fibulin 5 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Fibulin 5 cDNA ORF Clone, Human, N-HA tag Alternative Names
ADCL2 cDNA ORF Clone, Human;ARCL1A cDNA ORF Clone, Human;ARMD3 cDNA ORF Clone, Human;DANCE cDNA ORF Clone, Human;EVEC cDNA ORF Clone, Human;FIBL-5 cDNA ORF Clone, Human;UP50 cDNA ORF Clone, Human
Fibulin 5 Background Information
Full Name
fibulin 5

Fibulin 5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Fibulin 5 cDNA ORF Clone in Cloning Vector, Mouse MG58391-U
Fibulin 5 cDNA ORF Clone, Mouse, untagged MG58391-UT
Fibulin 5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58391-ACG
Fibulin 5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58391-ACGLN
Fibulin 5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58391-ACR
Fibulin 5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58391-CF
Fibulin 5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58391-NF
Fibulin 5 cDNA ORF Clone, Mouse, C-His tag MG58391-CH
Fibulin 5 cDNA ORF Clone, Mouse, N-His tag MG58391-NH
Fibulin 5 cDNA ORF Clone, Mouse, C-HA tag MG58391-CY
Fibulin 5 cDNA ORF Clone, Mouse, N-HA tag MG58391-NY
Fibulin 5 cDNA ORF Clone, Mouse, C-Myc tag MG58391-CM
Fibulin 5 cDNA ORF Clone, Mouse, N-Myc tag MG58391-NM

Fibulin 5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Fibulin 5 cDNA ORF Clone in Cloning Vector, Human HG11176-M
Fibulin 5 cDNA ORF Clone, Human, untagged HG11176-UT
Fibulin 5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11176-ACGLN
Fibulin 5 cDNA ORF Clone, Human, C-GFPSpark® tag HG11176-ACG
Fibulin 5 cDNA ORF Clone, Human, C-OFPSpark® tag HG11176-ACR
Fibulin 5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11176-CF
Fibulin 5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11176-NF
Fibulin 5 cDNA ORF Clone, Human, C-His tag HG11176-CH
Fibulin 5 cDNA ORF Clone, Human, N-His tag HG11176-NH
Fibulin 5 cDNA ORF Clone, Human, C-HA tag HG11176-CY
Fibulin 5 cDNA ORF Clone, Human, C-Myc tag HG11176-CM
Fibulin 5 cDNA ORF Clone, Human, N-Myc tag HG11176-NM
Fibulin 5 qPCR Primer Pairs, Human HP101082
info info
添加购物车成功! 添加购物车失败!