FHIT cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG14434-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FHIT Reagents
CRO Services
Product recommended

All FHIT Reagents
FHIT cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
444 bp
Description
Full length Clone DNA of Human fragile histidine triad with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FHIT cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
AP3Aase cDNA ORF Clone, Human;FRA3B cDNA ORF Clone, Human
FHIT Background Information

Fragile histidine triad, also known as FHIT, may play a key role in differentiating humans from apes. Fragile histidine triad gene belongs to the histidine triad gene family. It has been shown that fragile histidine triad synergizes with VHL, another tumor suppressor, in protecting against chemically - induced lung cancer. Fragile histidine triad gene works as a tumor suppressor as it has been demonstrated in animal studies. The exact molecular function of FHIT is still partially unclear. It also acts as a tumor suppressor of HER2/neu driven breast cancer.

Full Name
fragile histidine triad
References
  • Lambert N, et al. (2006) An RNA gene expressed during cortical development evolved rapidly in humans. Nature. 443(7108):167-72.
  • Pekarsky Y, et al. (1998) Nitrilase and Fhit homologs are encoded as fusion proteins in Drosophila melanogaster and Caenorhabditis elegans. Proc Natl Acad Sci. 95(15):8744-9.
  • Ohta M, et al. (1996) The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell. 84(4): 587-97.
  • FHIT cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FHIT cDNA ORF Clone in Cloning Vector, Mouse MG53334-U
    FHIT cDNA ORF Clone, Mouse, untagged MG53334-UT
    FHIT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53334-ACG
    FHIT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53334-ACGLN
    FHIT cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53334-ANG
    FHIT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53334-ACR
    FHIT cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53334-ANR
    FHIT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53334-CF
    FHIT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53334-NF
    FHIT cDNA ORF Clone, Mouse, C-His tag MG53334-CH
    FHIT cDNA ORF Clone, Mouse, N-His tag MG53334-NH
    FHIT cDNA ORF Clone, Mouse, C-HA tag MG53334-CY
    FHIT cDNA ORF Clone, Mouse, N-HA tag MG53334-NY
    FHIT cDNA ORF Clone, Mouse, C-Myc tag MG53334-CM
    FHIT cDNA ORF Clone, Mouse, N-Myc tag MG53334-NM

    FHIT cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FHIT cDNA ORF Clone in Cloning Vector, Human HG14434-G
    FHIT cDNA ORF Clone, Human, untagged HG14434-UT
    FHIT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14434-ACGLN
    FHIT cDNA ORF Clone, Human, C-GFPSpark® tag HG14434-ACG
    FHIT cDNA ORF Clone, Human, N-GFPSpark® tag HG14434-ANG
    FHIT cDNA ORF Clone, Human, C-OFPSpark® tag HG14434-ACR
    FHIT cDNA ORF Clone, Human, N-OFPSpark® tag HG14434-ANR
    FHIT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14434-NF
    FHIT cDNA ORF Clone, Human, C-His tag HG14434-CH
    FHIT cDNA ORF Clone, Human, N-His tag HG14434-NH
    FHIT cDNA ORF Clone, Human, C-HA tag HG14434-CY
    FHIT cDNA ORF Clone, Human, N-HA tag HG14434-NY
    FHIT cDNA ORF Clone, Human, C-Myc tag HG14434-CM
    FHIT cDNA ORF Clone, Human, N-Myc tag HG14434-NM
    FHIT qPCR Primer Pairs, Human HP103082
    info info
    添加购物车成功! 添加购物车失败!