FNDC4 cDNA ORF Clone, Human, N-Myc tag

Cat: HG15459-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FNDC4 Reagents
CRO Services
Product recommended

All FNDC4 Reagents
FNDC4 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
705 bp
Description
Full length Clone DNA of Human fibronectin type III domain containing 4 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FNDC4 cDNA ORF Clone, Human, N-Myc tag Alternative Names
FRCP1 cDNA ORF Clone, Human
FNDC4 Background Information
Full Name
fibronectin type III domain containing 4

FNDC4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FNDC4 cDNA ORF Clone in Cloning Vector, Mouse MG51357-U
FNDC4 cDNA ORF Clone, Mouse, untagged MG51357-UT
FNDC4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51357-ACG
FNDC4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51357-ACGLN
FNDC4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51357-ACR
FNDC4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51357-CF
FNDC4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51357-NF
FNDC4 cDNA ORF Clone, Mouse, C-His tag MG51357-CH
FNDC4 cDNA ORF Clone, Mouse, N-His tag MG51357-NH
FNDC4 cDNA ORF Clone, Mouse, C-HA tag MG51357-CY
FNDC4 cDNA ORF Clone, Mouse, N-HA tag MG51357-NY
FNDC4 cDNA ORF Clone, Mouse, C-Myc tag MG51357-CM
FNDC4 cDNA ORF Clone, Mouse, N-Myc tag MG51357-NM
FNDC4 qPCR Primer Pairs, Mouse MP201234

FNDC4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FNDC4 cDNA ORF Clone in Cloning Vector, Human HG15459-G
FNDC4 cDNA ORF Clone, Human, untagged HG15459-UT
FNDC4 cDNA ORF Clone, Human, C-GFPSpark® tag HG15459-ACG
FNDC4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15459-ACGLN
FNDC4 cDNA ORF Clone, Human, C-OFPSpark® tag HG15459-ACR
FNDC4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15459-CF
FNDC4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15459-NF
FNDC4 cDNA ORF Clone, Human, C-His tag HG15459-CH
FNDC4 cDNA ORF Clone, Human, N-His tag HG15459-NH
FNDC4 cDNA ORF Clone, Human, C-HA tag HG15459-CY
FNDC4 cDNA ORF Clone, Human, N-HA tag HG15459-NY
FNDC4 cDNA ORF Clone, Human, C-Myc tag HG15459-CM
FNDC4 qPCR Primer Pairs, Human HP104083
info info
添加购物车成功! 添加购物车失败!