After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 FSTL5 Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Human FSTL5 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_020116.3
cDNA 크기:2544bp
cDNA 설명:Full length Clone DNA of Homo sapiens follistatin-like 5 with C terminal His tag.
유전자 동의어:FSTL5
:Human
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
연구배경

FSTL5 may have molecular function (calcium ion binding) and to localize in various compartments (cytoplasm, extracellular space, extracellular region). FSTL5 expression denoted a dismal prognosis both within and across medulloblastoma subgroups. FSTL5 gene is well expressed, 1.0 times the average gene in this release. The sequence of this gene is defined by 120 GenBank accessions from 113 cDNA clones, some from brain, cerebellum, eye, melanotic melanoma, skin, amygdala, breast and 24 other tissues. FSTL5 gene contains 27 distinct introns. The addition of FSTL5 immunohistochemistry to existing molecular stratification schemes constitutes a reliable and cost-effective tool for prognostication in future clinical trials of medulloblastoma.

참고자료
  • Masuda T, et al. (2009) Laser capture microdissection and cDNA array analysis for identification of mouse KIAA/FLJ genes differentially expressed in the embryonic dorsal spinal cord. Brain Res. 1249:61-7.
  • Kingwell K. (2011) FSTL5--a new prognostic biomarker for medulloblastoma. Nat Rev Neurol. 7(11):598.
  • Remke M, et al. (2011) FSTL5 is a marker of poor prognosis in non-WNT/non-SHH medulloblastoma. J Clin Oncol. 29(29):3852-61.
  • Size / Price
    Cat No: HG13408-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".