휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-Flag 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 FUOM cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_001098483.1
    cDNA 크기:465bp
    cDNA 설명:Full length Clone DNA of Homo sapiens fucose mutarotase with N terminal Flag tag.
    유전자 동의어:FUCU, FucM, C10orf125
    :Human
    벡터:pCMV3-N-FLAG
    Plasmid:
    제한 사이트:
    태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FUOM qPCR primers for gene expression analysis, HP102631 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-Flag 태그 on other vectors
    휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG13974-ACG265260
    휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG13974-ACR265260
    휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG13974-ANG265260
    휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG13974-ANR265260
    휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, C-Flag 태그HG13974-CF229890
    휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, C-His 태그HG13974-CH229890
    휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, C-Myc 태그HG13974-CM229890
    휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, C-HA 태그HG13974-CY229890
    휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone in cloning vectorHG13974-G88420
    휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-Flag 태그HG13974-NF229890
    휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-His 태그HG13974-NH229890
    휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-Myc 태그HG13974-NM229890
    휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-HA 태그HG13974-NY229890
    휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmidHG13974-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    연구배경

    FUOM, also known as fucose mutarotase and FucM, belongs to the RbsD / FucU family. FUOM is involved in the interconversion between alpha- and beta-L-fucoses. L-Fucose has two isforms: alpha-L-fucose (29.5%) and beta-L-fucose (70.5%). The beta-form is metabolized through the salvage pathway. GDP-L-fucose formed either by the de novo or salvage pathways is transported into the endoplasmic reticulum, where it serves as a substrate for N- and O-glycosylations by fucosyltransferases. Fucosylated structures expressed on cell surfaces or secreted in biological fluids are believed to play a critical role in cell-cell adhesion and recognition processes. FUOM mainly exists as homodimer, but also functions as homotetramer, homooctamer, and homodecamer. FUOM's homodimeric form seems catalytically inactive.

    참고자료
  • Deloukas P. et al., 2004, Nature. 429: 375-81.
  • Ota T. et al., 2004, Nat Genet. 36: 40-5.
  • Dongkyu Park. et al., 2007, Glycobiology. 17 (9): 955-62.
  • Size / Price
    Cat No: HG13974-NF
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".