After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Human FUOM cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001098483.1
cDNA 크기:465bp
cDNA 설명:Full length Clone DNA of Homo sapiens fucose mutarotase with N terminal Flag tag.
유전자 동의어:FUCU, FucM, C10orf125
:Human
벡터:pCMV3-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-Flag 태그 on other vectors
휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG13974-ACG265260
휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG13974-ACR265260
휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG13974-ANG265260
휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG13974-ANR265260
휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, C-Flag 태그HG13974-CF229890
휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, C-His 태그HG13974-CH229890
휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, C-Myc 태그HG13974-CM229890
휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, C-HA 태그HG13974-CY229890
휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone in cloning vectorHG13974-G88420
휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-Flag 태그HG13974-NF229890
휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-His 태그HG13974-NH229890
휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-Myc 태그HG13974-NM229890
휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmid, N-HA 태그HG13974-NY229890
휴먼 FUOM / fucose mutarotase / FucM Gene ORF cDNA clone expression plasmidHG13974-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

FUOM, also known as fucose mutarotase and FucM, belongs to the RbsD / FucU family. FUOM is involved in the interconversion between alpha- and beta-L-fucoses. L-Fucose has two isforms: alpha-L-fucose (29.5%) and beta-L-fucose (70.5%). The beta-form is metabolized through the salvage pathway. GDP-L-fucose formed either by the de novo or salvage pathways is transported into the endoplasmic reticulum, where it serves as a substrate for N- and O-glycosylations by fucosyltransferases. Fucosylated structures expressed on cell surfaces or secreted in biological fluids are believed to play a critical role in cell-cell adhesion and recognition processes. FUOM mainly exists as homodimer, but also functions as homotetramer, homooctamer, and homodecamer. FUOM's homodimeric form seems catalytically inactive.

참고자료
  • Deloukas P. et al., 2004, Nature. 429: 375-81.
  • Ota T. et al., 2004, Nat Genet. 36: 40-5.
  • Dongkyu Park. et al., 2007, Glycobiology. 17 (9): 955-62.
  • Size / Price
    Cat No: HG13974-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".