휴먼 Frizzled-1/FZD1 Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
    휴먼 FZD1 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_003505.1
    cDNA 크기:1944bp
    cDNA 설명:Full length Clone DNA of Homo sapiens frizzled family receptor 1 DNA.
    유전자 동의어:FLJ95923, DKFZp564G072, FZD1
    :Human
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FZD1 qPCR primers for gene expression analysis, HP103855 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    연구배경

    Frizzled-1, also known as FZD1, belongs to the G-protein coupled receptor Fz/Smo family. FZD1 contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, 7 transmembrane domains, and a C-terminal PDZ domain-binding motif. FZD1 is expressed in adult heart, placenta, lung, kidney, pancreas, prostate, and ovary and in fetal lung and kidney. Frizzled is a family of G protein-coupled receptor proteins that serve as receptors in the Wnt signaling pathway and other signaling pathways. When activated, Frizzled leads to activation of Dishevelled in the cytosol. Frizzled proteins and the genes encoding them have been identified in an array of animals, from sponges to humans. Frizzled proteins play key roles in governing cell polarity, embryonic development, formation of neural synapses, cell proliferation, and many other processes in developing and adult organisms. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes.

    Size / Price
    Cat No: HG15229-UT
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".