After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 G6PD Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human G6PD cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000402.3
cDNA 크기:1638bp
cDNA 설명:Full length Clone DNA of Homo sapiens glucose-6-phosphate dehydrogenase.
유전자 동의어:G6PD1, G6PD
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-G6PD-t1
제한 사이트:HindIII + XbaI (6.1kb + 1.64kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1401 C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human G6PD Gene Plasmid Map
Human G6PD Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Cat No: HG12021-UT
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보In Stock
대량 주문 문의장바구니에 추가
Contact Us
이미지
  • Human G6PD Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".