After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

Human GALK1 ORF mammalian expression plasmid, N-His tag

데이터시트리뷰관련제품프로토콜
Human GALK1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000154.1
cDNA 크기:1179bp
cDNA 설명:Full length Clone DNA of Homo sapiens galactokinase 1 with N terminal His tag.
유전자 동의어:GK1, GALK, GALK1
:Human
벡터:pCMV3-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Galactokinase, also known as Galactose kinase, GALK and GALK1, is a protein which belongs to the GHMP kinase family and GalK subfamily. Galactokinase / GALK1 is a major enzyme for galactose metabolism. Galactokinase (GALK) deficiency is an autosomal recessive disorder characterized by elevation of blood galactose concentration and diminished galactose-1-phosphate, leading to the production of galactitol. Defects in GALK1 are the cause of galactosemia II ( GALCT2 ) which II is an autosomal recessive deficiency characterized by congenital cataracts during infancy and presenile cataracts in the adult population. The cataracts are secondary to accumulation of galactitol in the lenses.

참고자료
  • Hunter,M. et al., 2001, Hum Mutat. 17 (1):77-8.
  • Park,H.D. et al., 2007, Mol Genet Metab. 91 (3):234-8.
  • Park,H.D. et al., 2009, BMC Med Genet. 10 :29.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".