GALNT7 cDNA ORF Clone, Human, N-HA tag

Cat: HG15197-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GALNT7 Reagents

CRO Services

Product recommended


All GALNT7 Reagents

GALNT7 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1974 bp
Description
Full length Clone DNA of Human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GALNT7 cDNA ORF Clone, Human, N-HA tag Alternative Names

GALNAC-T7 cDNA ORF Clone, Human;GalNAcT7 cDNA ORF Clone, Human

GALNT7 Background Information

Full Name
polypeptide N-acetylgalactosaminyltransferase 7

GALNT7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GALNT7 cDNA ORF Clone in Cloning Vector, Rat RG87814-U
GALNT7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87814-ACGLN

GALNT7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GALNT7 cDNA ORF Clone in Cloning Vector, Mouse MG5A3221-U
GALNT7 cDNA ORF Clone, Mouse, untagged MG5A3221-UT
GALNT7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3221-ACGLN
GALNT7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3221-ACG
GALNT7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3221-ANG
GALNT7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3221-ACR
GALNT7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3221-ANR
GALNT7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3221-CF
GALNT7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3221-NF
GALNT7 cDNA ORF Clone, Mouse, C-His tag MG5A3221-CH
GALNT7 cDNA ORF Clone, Mouse, N-His tag MG5A3221-NH
GALNT7 cDNA ORF Clone, Mouse, C-HA tag MG5A3221-CY
GALNT7 cDNA ORF Clone, Mouse, N-HA tag MG5A3221-NY
GALNT7 cDNA ORF Clone, Mouse, C-Myc tag MG5A3221-CM
GALNT7 cDNA ORF Clone, Mouse, N-Myc tag MG5A3221-NM

GALNT7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GALNT7 cDNA ORF Clone in Cloning Vector, Human HG15197-G
GALNT7 cDNA ORF Clone, Human, untagged HG15197-UT
GALNT7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15197-ACGLN
GALNT7 cDNA ORF Clone, Human, C-GFPSpark® tag HG15197-ACG
GALNT7 cDNA ORF Clone, Human, C-OFPSpark® tag HG15197-ACR
GALNT7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15197-CF
GALNT7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15197-NF
GALNT7 cDNA ORF Clone, Human, C-His tag HG15197-CH
GALNT7 cDNA ORF Clone, Human, N-His tag HG15197-NH
GALNT7 cDNA ORF Clone, Human, C-HA tag HG15197-CY
GALNT7 cDNA ORF Clone, Human, C-Myc tag HG15197-CM
GALNT7 cDNA ORF Clone, Human, N-Myc tag HG15197-NM
GALNT7 qPCR Primer Pairs, Human HP103823
info info
添加购物车成功! 添加购物车失败!