휴먼 GBA/glucocerebrosidase Gene ORF cDNA clone expression plasmid

  • Human GBA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
데이터시트리뷰관련제품프로토콜
휴먼 GBA cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000157
cDNA 크기:1611bp
cDNA 설명:Full length Clone DNA of Homo sapiens glucosidase, beta, acid.
유전자 동의어:GBA1
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-GBA
제한 사이트:NheI + XbaI (6.1kb + 1.61kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with GBA qPCR primers for gene expression analysis, HP101572 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
휴먼 GBA Gene Plasmid Map
Human GBA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Cat No: HG12038-UT
정가: 
가격:      (You Save: )

Datasheet & Documentation

Contact Us
    최근에 조회한 품목
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".