After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

휴먼 GBA/glucocerebrosidase Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Human GBA cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000157
cDNA 크기:1611bp
cDNA 설명:Full length Clone DNA of Homo sapiens glucosidase, beta, acid.
유전자 동의어:GBA1
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-GBA
제한 사이트:NheI + XbaI (6.1kb + 1.61kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Human GBA Gene Plasmid Map
Human GBA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Cat No: HG12038-UT
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보In Stock
대량 주문 문의장바구니에 추가
Contact Us
이미지
  • Human GBA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    최근에 조회한 품목
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".