GCSH cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14568-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GCSH Reagents

CRO Services

Product recommended


All GCSH Reagents

GCSH cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
522 bp
Description
Full length Clone DNA of Human glycine cleavage system protein H (aminomethyl carrier) with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GCSH cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

GCE cDNA ORF Clone, Human;NKH cDNA ORF Clone, Human

GCSH Background Information

Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). GCSH is the H protein, which transfers the methylamine group of glycine from the P protein to the T protein. Defects in GCSH gene are a cause of nonketotic hyperglycinemia (NKH). Two transcript variants, one protein-coding and the other probably not protein-coding,have been found for GCSH gene. Also, several transcribed and non-transcribed pseudogenes of GCSH gene exist throughout the genome.

Full Name
glycine cleavage system protein H (aminomethyl carrier)
References
  • Hiraga K. et al., 1988, Biochem Biophys Res Commun. 151 (2): 758-62.
  • Fujiwara K. et al., 1991, Biochem Biophys Res Commun. 176 (2): 711-6.
  • Koyata H. et al., 1991, Am J Hum Genet. 48 (2): 351-61.
  • GCSH cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GCSH cDNA ORF Clone in Cloning Vector, Mouse MG5A6771-U
    GCSH cDNA ORF Clone, Mouse, untagged MG5A6771-UT
    GCSH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6771-ACGLN
    GCSH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6771-ACG
    GCSH cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A6771-ANG
    GCSH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A6771-ACR
    GCSH cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A6771-ANR
    GCSH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A6771-CF
    GCSH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A6771-NF
    GCSH cDNA ORF Clone, Mouse, C-His tag MG5A6771-CH
    GCSH cDNA ORF Clone, Mouse, N-His tag MG5A6771-NH
    GCSH cDNA ORF Clone, Mouse, C-HA tag MG5A6771-CY
    GCSH cDNA ORF Clone, Mouse, N-HA tag MG5A6771-NY
    GCSH cDNA ORF Clone, Mouse, C-Myc tag MG5A6771-CM
    GCSH cDNA ORF Clone, Mouse, N-Myc tag MG5A6771-NM

    GCSH cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GCSH cDNA ORF Clone in Cloning Vector, Human HG14568-G
    GCSH cDNA ORF Clone, Human, untagged HG14568-UT
    GCSH cDNA ORF Clone, Human, C-GFPSpark® tag HG14568-ACG
    GCSH Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14568-ACGLN
    GCSH cDNA ORF Clone, Human, N-GFPSpark® tag HG14568-ANG
    GCSH cDNA ORF Clone, Human, C-OFPSpark® tag HG14568-ACR
    GCSH cDNA ORF Clone, Human, N-OFPSpark® tag HG14568-ANR
    GCSH cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14568-CF
    GCSH cDNA ORF Clone, Human, C-His tag HG14568-CH
    GCSH cDNA ORF Clone, Human, N-His tag HG14568-NH
    GCSH cDNA ORF Clone, Human, C-HA tag HG14568-CY
    GCSH cDNA ORF Clone, Human, N-HA tag HG14568-NY
    GCSH cDNA ORF Clone, Human, C-Myc tag HG14568-CM
    GCSH cDNA ORF Clone, Human, N-Myc tag HG14568-NM
    GCSH qPCR Primer Pairs, Human HP103208
    info info
    添加购物车成功! 添加购物车失败!