G protein alpha S cDNA ORF Clone, Human, C-HA tag

Cat: HG12069-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All G protein alpha S Reagents

CRO Services

Product recommended


All G protein alpha S Reagents

G protein alpha S cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1185 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human GNAS complex locus, transcript variant 3 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.19kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

G protein alpha S cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

G protein alpha S cDNA ORF Clone, Human, C-HA tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5612

G protein alpha S cDNA ORF Clone, Human, C-HA tag Alternative Names

AHO cDNA ORF Clone, Human;C20orf45 cDNA ORF Clone, Human;GNAS1 cDNA ORF Clone, Human;GPSA cDNA ORF Clone, Human;GSA cDNA ORF Clone, Human;GSP cDNA ORF Clone, Human;NESP cDNA ORF Clone, Human;PHP1A cDNA ORF Clone, Human;PHP1B cDNA ORF Clone, Human;PHP1C cDNA ORF Clone, Human;POH cDNA ORF Clone, Human;SgVI cDNA ORF Clone, Human

G protein alpha S Background Information

Full Name
GNAS complex locus

G protein alpha S cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
G protein alpha S cDNA ORF Clone in Cloning Vector, Rat RG81927-U
G protein alpha S Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81927-ACGLN

G protein alpha S cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
G protein alpha S cDNA ORF Clone in Cloning Vector, Mouse MG52037-G
G protein alpha S cDNA ORF Clone, Mouse, untagged MG52037-UT
G protein alpha S Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52037-ACGLN
G protein alpha S cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52037-ACG
G protein alpha S cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52037-ACR
G protein alpha S cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52037-CF
G protein alpha S cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52037-NF
G protein alpha S cDNA ORF Clone, Mouse, C-His tag MG52037-CH
G protein alpha S cDNA ORF Clone, Mouse, N-His tag MG52037-NH
G protein alpha S cDNA ORF Clone, Mouse, C-HA tag MG52037-CY
G protein alpha S cDNA ORF Clone, Mouse, N-HA tag MG52037-NY
G protein alpha S cDNA ORF Clone, Mouse, C-Myc tag MG52037-CM
G protein alpha S cDNA ORF Clone, Mouse, N-Myc tag MG52037-NM
G protein alpha S qPCR Primer Pairs, Mouse MP201910

G protein alpha S cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
G protein alpha S cDNA ORF Clone in Cloning Vector, Human HG12069-G
G protein alpha S cDNA ORF Clone, Human, untagged HG12069-UT
G protein alpha S Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12069-ACGLN
G protein alpha S cDNA ORF Clone, Human, C-GFPSpark® tag HG12069-ACG
G protein alpha S cDNA ORF Clone, Human, C-OFPSpark® tag HG12069-ACR
G protein alpha S cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12069-CF
G protein alpha S cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12069-NF
G protein alpha S cDNA ORF Clone, Human, C-His tag HG12069-CH
G protein alpha S cDNA ORF Clone, Human, N-His tag HG12069-NH
G protein alpha S cDNA ORF Clone, Human, N-HA tag HG12069-NY
G protein alpha S cDNA ORF Clone, Human, C-Myc tag HG12069-CM
G protein alpha S cDNA ORF Clone, Human, N-Myc tag HG12069-NM
G protein alpha S qPCR Primer Pairs, Human HP101598
info info
添加购物车成功! 添加购物车失败!