GNG10 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16346-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GNG10 Reagents
CRO Services
Product recommended

All GNG10 Reagents
GNG10 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
207 bp
Description
Full length Clone DNA of Human guanine nucleotide binding protein (G protein), gamma 10 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GNG10 Background Information
Full Name
guanine nucleotide binding protein (G protein), gamma 10

GNG10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GNG10 cDNA ORF Clone in Cloning Vector, Rat RG86131-U
GNG10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86131-ACGLN

GNG10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GNG10 cDNA ORF Clone in Cloning Vector, Mouse MG53396-U
GNG10 cDNA ORF Clone, Mouse, untagged MG53396-UT
GNG10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53396-ACGLN
GNG10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53396-ACG
GNG10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53396-ACR
GNG10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53396-CF
GNG10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53396-NF
GNG10 cDNA ORF Clone, Mouse, C-His tag MG53396-CH
GNG10 cDNA ORF Clone, Mouse, N-His tag MG53396-NH
GNG10 cDNA ORF Clone, Mouse, C-HA tag MG53396-CY
GNG10 cDNA ORF Clone, Mouse, N-HA tag MG53396-NY
GNG10 cDNA ORF Clone, Mouse, C-Myc tag MG53396-CM
GNG10 cDNA ORF Clone, Mouse, N-Myc tag MG53396-NM

GNG10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GNG10 cDNA ORF Clone in Cloning Vector, Human HG16346-G
GNG10 cDNA ORF Clone, Human, untagged HG16346-UT
GNG10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16346-ACGLN
GNG10 cDNA ORF Clone, Human, C-GFPSpark® tag HG16346-ACG
GNG10 cDNA ORF Clone, Human, C-OFPSpark® tag HG16346-ACR
GNG10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16346-CF
GNG10 cDNA ORF Clone, Human, C-His tag HG16346-CH
GNG10 cDNA ORF Clone, Human, N-His tag HG16346-NH
GNG10 cDNA ORF Clone, Human, C-HA tag HG16346-CY
GNG10 cDNA ORF Clone, Human, N-HA tag HG16346-NY
GNG10 cDNA ORF Clone, Human, C-Myc tag HG16346-CM
GNG10 cDNA ORF Clone, Human, N-Myc tag HG16346-NM
GNG10 qPCR Primer Pairs, Human HP105099
info info
添加购物车成功! 添加购物车失败!