휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-HA 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 GOT1 cDNA 클론 제품 정보
    Gene_bank_ref_id:BC000498
    cDNA 크기:1242bp
    cDNA 설명:Full length Clone DNA of Homo sapiens glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) with N terminal HA tag.
    유전자 동의어:ASTQTL1, GIG18, GOT1
    :Human
    벡터:pCMV3-N-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GOT1 qPCR primers for gene expression analysis, HP102847 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-HA 태그 on other vectors
    휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG14196-ACG265260
    휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG14196-ACR265260
    휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG14196-ANG265260
    휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG14196-ANR265260
    휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG14196-CF229890
    휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, C-His 태그HG14196-CH229890
    휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG14196-CM229890
    휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG14196-CY229890
    휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone in cloning vectorHG14196-G88420
    휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG14196-NF229890
    휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-His 태그HG14196-NH229890
    휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG14196-NM229890
    휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG14196-NY229890
    휴먼 Aspartate aminotransferase / GOT1 Gene ORF cDNA clone expression plasmidHG14196-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    연구배경

    Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

    참고자료
  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Size / Price
    Cat No: HG14196-NY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".