After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

휴먼 GP1BB/CD42c Gene ORF cDNA clone expression plasmid, N-His 태그

데이터시트리뷰관련제품프로토콜
Human GP1BB cDNA 클론 제품 정보
Gene_bank_ref_id:NM_000407.4
cDNA 크기:621bp
cDNA 설명:Full length Clone DNA of Homo sapiens glycoprotein Ib (platelet), beta polypeptide with N terminal His tag.
유전자 동의어:CD42c, GP1BB
:Human
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Platelet glycoprotein Ib (GPIb) complex is best known as a major platelet receptor for von Willebrand factor essential for platelet adhesion under high shear conditions found in arteries and in thrombosis. The GPIb complex is composed of GPIb alpha (Platelet glycoprotein Ib alpha chain) covalently attached to GPIb beta (Platelet glycoprotein Ib beta chain) and noncovalently complexed with GPIX and GPV. GPIb-beta, also known as GP1BB, CD42b-beta and CD42c, is single-pass type I membrane protein expressed in heart and brain, which is a critical component of the von Willebrand factor (vWF) receptor. The cysteine knot region of GPIb beta in the N terminus is critical for the conformation of GPIb beta that interacts with GPIX. The precursor of GP1BB is synthesized from a 1.0 kb mRNA expressed in plateletes and megakaryocytes. GPIb is a heterodimeric transmembrane protein consisting of a disulfide-linked 140 kD alpha chain and 22 kD beta chain. GPIb alpha chain provides the vWF binding site, and GPIb beta chain contributes to surface expression of the receptor and participates in transmembrane signaling through phosphorylation of its intracellular domain. GP1BB is part of the GPIb-V-IX system that constitutes the receptor for von Willebrand factor (vWF), and mediates platelet adhesion in the arterial circulation. Defects in GP1BB are a cause of Bernard-Soulier syndrome (BSS), also known as giant platelet disease (GPD). BSS patients have unusually large platelets and have a clinical bleeding tendency.

참고자료
  • Kenny D, et al. (2002) The cysteine knot of platelet glycoprotein Ib beta (GPIb beta) is critical for the interaction of GPIb beta with GPIX. Blood. 99(12): 4428-33.
  • Tang J,et al. (2004) Mutation in the leucine-rich repeat C-flanking region of platelet glycoprotein Ib beta impairs assembly of von Willebrand factor receptor. Thromb Haemost. 92(1): 75-88.
  • Vanhoorelbeke K, et al. (2007) Inhibition of platelet glycoprotein Ib and its antithrombotic potential. Curr Pharm Des. 13(26): 2684-97.
  • Clemetson KJ, et al. (2008) Platelet GPIb complex as a target for anti-thrombotic drug development. Thromb Haemost. 99(3): 473-9.
  • Size / Price
    Cat No: HG10742-NH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".