GPX2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16332-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GPX2 Reagents
CRO Services
Product recommended

All GPX2 Reagents
GPX2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
612 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human glutathione peroxidase 2 (gastrointestinal) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI+XbaI(6kb+0.61kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
GPX2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GPX2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human aFGF/FGF1 Gene Plasmid Map 5637
GPX2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
GI-GPx cDNA ORF Clone, Human;GPRP cDNA ORF Clone, Human;GPRP-2 cDNA ORF Clone, Human;GPx-2 cDNA ORF Clone, Human;GPx-GI cDNA ORF Clone, Human;GSHPx-2 cDNA ORF Clone, Human;GSHPX-GI cDNA ORF Clone, Human
GPX2 Background Information
Full Name
glutathione peroxidase 2

GPX2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GPX2 cDNA ORF Clone in Cloning Vector, Rat RG80753-U
GPX2 cDNA ORF Clone, Rat, untagged RG80753-UT
GPX2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80753-ACG
GPX2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80753-ACGLN
GPX2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80753-ANG
GPX2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80753-ACR
GPX2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80753-ANR
GPX2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80753-CF
GPX2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80753-NF
GPX2 cDNA ORF Clone, Rat, C-His tag RG80753-CH
GPX2 cDNA ORF Clone, Rat, N-His tag RG80753-NH
GPX2 cDNA ORF Clone, Rat, C-HA tag RG80753-CY
GPX2 cDNA ORF Clone, Rat, N-HA tag RG80753-NY
GPX2 cDNA ORF Clone, Rat, C-Myc tag RG80753-CM
GPX2 cDNA ORF Clone, Rat, N-Myc tag RG80753-NM
GPX2 qPCR Primer Pairs, Rat RP300717

GPX2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GPX2 cDNA ORF Clone in Cloning Vector, Human HG16332-G
GPX2 cDNA ORF Clone, Human, untagged HG16332-UT
GPX2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16332-ACG
GPX2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16332-ACGLN
GPX2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16332-ANG
GPX2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16332-ACR
GPX2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16332-ANR
GPX2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16332-CF
GPX2 cDNA ORF Clone, Human, C-His tag HG16332-CH
GPX2 cDNA ORF Clone, Human, N-His tag HG16332-NH
GPX2 cDNA ORF Clone, Human, C-HA tag HG16332-CY
GPX2 cDNA ORF Clone, Human, N-HA tag HG16332-NY
GPX2 cDNA ORF Clone, Human, C-Myc tag HG16332-CM
GPX2 cDNA ORF Clone, Human, N-Myc tag HG16332-NM
GPX2 qPCR Primer Pairs, Human HP105085
info info
添加购物车成功! 添加购物车失败!