휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그

    데이터시트리뷰관련제품프로토콜
    휴먼 GSTM2 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_000848
    cDNA 크기:657bp
    cDNA 설명:Full length Clone DNA of Homo sapiens glutathione S-transferase mu 2 (muscle), transcript variant 1 with C terminal His tag.
    유전자 동의어:GST4
    :Human
    벡터:pCMV3-C-His
    Plasmid:
    제한 사이트:
    태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GSTM2 qPCR primers for gene expression analysis, HP101576 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그 on other vectors
    휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그HG12042-ACG265260
    휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그HG12042-ACR265260
    휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그HG12042-ANG265260
    휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그HG12042-ANR265260
    휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그HG12042-CF229890
    휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그HG12042-CH229890
    휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그HG12042-CM229890
    휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그HG12042-CY229890
    휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG12042-G88420
    휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그HG12042-NF229890
    휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그HG12042-NH229890
    휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그HG12042-NM229890
    휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA 태그HG12042-NY229890
    휴먼 GSTM2 transcript variant 1 Gene ORF cDNA clone expression plasmidHG12042-UT229890
     발현 벡터에 대해 자세히 알아보기
    Product nameProduct name
    연구배경

    Glutathione S-transferase Mu 2, also known as GST class-mu 2, GSTM2-2 and GSTM2, is a cytoplasm protein which belongs to the GST superfamily and Mu family. GSTM2 / GST4 contains one GST C-terminal domain and one GST N-terminal domain. The glutathione S-transferases (GSTs) are a multigene family of enzymes largely involved in the detoxification of chemicals. Eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. Butyrate, an important luminal component produced from fermentation of dietary fibers, is an efficient inducer of GSTs and especially of GSTM2. Butyrate may act chemoprotectively by increasing detoxification capabilities in the colon mucosa.

    참고자료
  • Campbell E, et al.,1990, J Biol Chem 265 (16): 9188-93. 
  • Vorachek WR, et al.,1991, Proc Natl Acad Sci USA. 88 (10): 4443-7.
  • Ebert,M.N. et al., 2003, Carcinogenesis. 24 (10):1637-44.
  • Size / Price
    Cat No: HG12042-CH
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".