GSTZ1 cDNA ORF Clone, Human, untagged

Cat: HG14237-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GSTZ1 Reagents

CRO Services

Product recommended


All GSTZ1 Reagents

GSTZ1 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
651 bp
Description
Full length Clone DNA of Human glutathione S-transferase zeta 1.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GSTZ1 cDNA ORF Clone, Human, untagged Alternative Names

GSTZ1 cDNA ORF Clone, Human;GSTZ1-1 cDNA ORF Clone, Human;MAAI cDNA ORF Clone, Human;MAI cDNA ORF Clone, Human

GSTZ1 Background Information

GSTZ1 gene is a member of the glutathione S-transferase (GSTs) super-family which encodes multifunctional enzymes important in the detoxification of electrophilic molecules, including carcinogens, mutagens, and several therapeutic drugs, by conjugation with glutathione. GSTZ1 is a bifunctional protein which has minimal glutathione-conjugating activity with ethacrynic acid and 7-chloro-4-nitrobenz-2-oxa-1,3-diazole and maleylacetoacetate isomerase activity. GSTZ1 catalyzes the glutathione dependent oxygenation of dichloroacetic acid to glyoxylic acid. GSTZ1 participates in the catabolism of phenylalanine and tyrosine. Thus defects in GSTZ1 cause harsh metabolic disorders including alkaptonuria, phenylketonuria and tyrosinaemia.

Full Name
glutathione S-transferase zeta 1
References
  • Tong Z. et al., 1999, Chem Res Toxicol. 11 (11): 1332-8.
  • Tong Z. et al., 1999, Biochem J. 331 (2): 371-4.
  • Ketterer B. 2001, Chem Biol Interact. 138 (1): 27-42.
  • GSTZ1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    GSTZ1 cDNA ORF Clone in Cloning Vector, Rat RG80936-U
    GSTZ1 cDNA ORF Clone, Rat, untagged RG80936-UT
    GSTZ1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80936-ACG
    GSTZ1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80936-ACGLN
    GSTZ1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80936-ANG
    GSTZ1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80936-ACR
    GSTZ1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80936-ANR
    GSTZ1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80936-CF
    GSTZ1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80936-NF
    GSTZ1 cDNA ORF Clone, Rat, C-His tag RG80936-CH
    GSTZ1 cDNA ORF Clone, Rat, N-His tag RG80936-NH
    GSTZ1 cDNA ORF Clone, Rat, C-HA tag RG80936-CY
    GSTZ1 cDNA ORF Clone, Rat, N-HA tag RG80936-NY
    GSTZ1 cDNA ORF Clone, Rat, C-Myc tag RG80936-CM
    GSTZ1 cDNA ORF Clone, Rat, N-Myc tag RG80936-NM
    GSTZ1 qPCR Primer Pairs, Rat RP300900

    GSTZ1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GSTZ1 cDNA ORF Clone in Cloning Vector, Mouse MG51808-G
    GSTZ1 cDNA ORF Clone, Mouse, untagged MG51808-UT
    GSTZ1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51808-ACGLN
    GSTZ1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51808-ACG
    GSTZ1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51808-ANG
    GSTZ1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51808-ACR
    GSTZ1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51808-ANR
    GSTZ1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51808-CF
    GSTZ1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51808-NF
    GSTZ1 cDNA ORF Clone, Mouse, C-His tag MG51808-CH
    GSTZ1 cDNA ORF Clone, Mouse, N-His tag MG51808-NH
    GSTZ1 cDNA ORF Clone, Mouse, C-HA tag MG51808-CY
    GSTZ1 cDNA ORF Clone, Mouse, N-HA tag MG51808-NY
    GSTZ1 cDNA ORF Clone, Mouse, C-Myc tag MG51808-CM
    GSTZ1 cDNA ORF Clone, Mouse, N-Myc tag MG51808-NM
    GSTZ1 qPCR Primer Pairs, Mouse MP201681

    GSTZ1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GSTZ1 cDNA ORF Clone in Cloning Vector, Human HG14237-G
    GSTZ1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14237-ACGLN
    GSTZ1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14237-ACG
    GSTZ1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14237-ANG
    GSTZ1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14237-ACR
    GSTZ1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14237-ANR
    GSTZ1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14237-CF
    GSTZ1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14237-NF
    GSTZ1 cDNA ORF Clone, Human, C-His tag HG14237-CH
    GSTZ1 cDNA ORF Clone, Human, N-His tag HG14237-NH
    GSTZ1 cDNA ORF Clone, Human, C-HA tag HG14237-CY
    GSTZ1 cDNA ORF Clone, Human, N-HA tag HG14237-NY
    GSTZ1 cDNA ORF Clone, Human, C-Myc tag HG14237-CM
    GSTZ1 cDNA ORF Clone, Human, N-Myc tag HG14237-NM
    GSTZ1 qPCR Primer Pairs, Human HP102887
    info info
    添加购物车成功! 添加购物车失败!