H2AFV cDNA ORF Clone, Human, N-Myc tag

Cat: HG14327-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All H2AFV Reagents
CRO Services
Product recommended

All H2AFV Reagents
H2AFV cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
387 bp
Description
Full length Clone DNA of Human H2A histone family, member V with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

H2AFV cDNA ORF Clone, Human, N-Myc tag Alternative Names
H2A.Z-2 cDNA ORF Clone, Human;H2AV cDNA ORF Clone, Human
H2AFV Background Information
Full Name
H2A histone family member V
Research Areas

H2AFV cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
H2AFV cDNA ORF Clone in Cloning Vector, Mouse MG53844-U
H2AFV cDNA ORF Clone, Mouse, untagged MG53844-UT
H2AFV cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53844-ACG
H2AFV Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53844-ACGLN
H2AFV cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53844-ANG
H2AFV cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53844-ACR
H2AFV cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53844-ANR
H2AFV cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53844-CF
H2AFV cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53844-NF
H2AFV cDNA ORF Clone, Mouse, C-His tag MG53844-CH
H2AFV cDNA ORF Clone, Mouse, N-His tag MG53844-NH
H2AFV cDNA ORF Clone, Mouse, C-HA tag MG53844-CY
H2AFV cDNA ORF Clone, Mouse, N-HA tag MG53844-NY
H2AFV cDNA ORF Clone, Mouse, C-Myc tag MG53844-CM
H2AFV cDNA ORF Clone, Mouse, N-Myc tag MG53844-NM

H2AFV cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
H2AFV cDNA ORF Clone in Cloning Vector, Human HG14327-G
H2AFV cDNA ORF Clone, Human, untagged HG14327-UT
H2AFV Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14327-ACGLN
H2AFV cDNA ORF Clone, Human, C-GFPSpark® tag HG14327-ACG
H2AFV cDNA ORF Clone, Human, N-GFPSpark® tag HG14327-ANG
H2AFV cDNA ORF Clone, Human, C-OFPSpark® tag HG14327-ACR
H2AFV cDNA ORF Clone, Human, N-OFPSpark® tag HG14327-ANR
H2AFV cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14327-CF
H2AFV cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14327-NF
H2AFV cDNA ORF Clone, Human, C-His tag HG14327-CH
H2AFV cDNA ORF Clone, Human, N-His tag HG14327-NH
H2AFV cDNA ORF Clone, Human, C-HA tag HG14327-CY
H2AFV cDNA ORF Clone, Human, N-HA tag HG14327-NY
H2AFV cDNA ORF Clone, Human, C-Myc tag HG14327-CM
H2AFV qPCR Primer Pairs, Human HP102977
info info
添加购物车成功! 添加购物车失败!