HARS/HisRS cDNA ORF Clone, Human, N-Myc tag

Cat: HG10172-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HARS/HisRS Reagents
CRO Services
Product recommended

All HARS/HisRS Reagents
HARS/HisRS cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1530 bp
Description
Full length Clone DNA of Human histidyl-tRNA synthetase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HARS/HisRS cDNA ORF Clone, Human, N-Myc tag Alternative Names
HRS cDNA ORF Clone, Human;USH3B cDNA ORF Clone, Human
HARS/HisRS Background Information
Full Name
histidyl-tRNA synthetase

HARS/HisRS cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HARS/HisRS cDNA ORF Clone in Cloning Vector, Mouse MG5A4390-U
HARS/HisRS cDNA ORF Clone, Mouse, untagged MG5A4390-UT
HARS/HisRS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4390-ACG
HARS/HisRS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4390-ACGLN
HARS/HisRS cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4390-ANG
HARS/HisRS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4390-ACR
HARS/HisRS cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4390-ANR
HARS/HisRS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4390-CF
HARS/HisRS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4390-NF
HARS/HisRS cDNA ORF Clone, Mouse, C-His tag MG5A4390-CH
HARS/HisRS cDNA ORF Clone, Mouse, N-His tag MG5A4390-NH
HARS/HisRS cDNA ORF Clone, Mouse, C-HA tag MG5A4390-CY
HARS/HisRS cDNA ORF Clone, Mouse, N-HA tag MG5A4390-NY
HARS/HisRS cDNA ORF Clone, Mouse, C-Myc tag MG5A4390-CM
HARS/HisRS cDNA ORF Clone, Mouse, N-Myc tag MG5A4390-NM

HARS/HisRS cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HARS/HisRS cDNA ORF Clone in Cloning Vector, Human HG10172-M
HARS/HisRS cDNA ORF Clone, Human, untagged HG10172-UT
HARS/HisRS cDNA ORF Clone, Human, C-GFPSpark® tag HG10172-ACG
HARS/HisRS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10172-ACGLN
HARS/HisRS cDNA ORF Clone, Human, N-GFPSpark® tag HG10172-ANG
HARS/HisRS cDNA ORF Clone, Human, C-OFPSpark® tag HG10172-ACR
HARS/HisRS cDNA ORF Clone, Human, N-OFPSpark® tag HG10172-ANR
HARS/HisRS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10172-CF
HARS/HisRS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10172-NF
HARS/HisRS cDNA ORF Clone, Human, C-His tag HG10172-CH
HARS/HisRS cDNA ORF Clone, Human, N-His tag HG10172-NH
HARS/HisRS cDNA ORF Clone, Human, C-HA tag HG10172-CY
HARS/HisRS cDNA ORF Clone, Human, N-HA tag HG10172-NY
HARS/HisRS cDNA ORF Clone, Human, C-Myc tag HG10172-CM
HARS/HisRS qPCR Primer Pairs, Human HP100240
info info
添加购物车成功! 添加购物车失败!