KAT1 cDNA ORF Clone, Human, untagged

Cat: HG15255-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All KAT1 Reagents
CRO Services
Product recommended

All KAT1 Reagents
KAT1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1005 bp
Description
Full length Clone DNA of Human histone acetyltransferase 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KAT1 cDNA ORF Clone, Human, untagged Alternative Names
KAT1 cDNA ORF Clone, Human
KAT1 Background Information
Full Name
histone acetyltransferase 1

KAT1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KAT1 cDNA ORF Clone in Cloning Vector, Mouse MG52001-U
KAT1 cDNA ORF Clone, Mouse, untagged MG52001-UT
KAT1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52001-ACG
KAT1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52001-ACGLN
KAT1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52001-ANG
KAT1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52001-ACR
KAT1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52001-ANR
KAT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52001-CF
KAT1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52001-NF
KAT1 cDNA ORF Clone, Mouse, C-His tag MG52001-CH
KAT1 cDNA ORF Clone, Mouse, N-His tag MG52001-NH
KAT1 cDNA ORF Clone, Mouse, C-HA tag MG52001-CY
KAT1 cDNA ORF Clone, Mouse, N-HA tag MG52001-NY
KAT1 cDNA ORF Clone, Mouse, C-Myc tag MG52001-CM
KAT1 cDNA ORF Clone, Mouse, N-Myc tag MG52001-NM
KAT1 qPCR Primer Pairs, Mouse MP201874

KAT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KAT1 cDNA ORF Clone in Cloning Vector, Human HG15255-G
KAT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15255-ACGLN
KAT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15255-ACG
KAT1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15255-ANG
KAT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15255-ACR
KAT1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15255-ANR
KAT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15255-CF
KAT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15255-NF
KAT1 cDNA ORF Clone, Human, C-His tag HG15255-CH
KAT1 cDNA ORF Clone, Human, N-His tag HG15255-NH
KAT1 cDNA ORF Clone, Human, C-HA tag HG15255-CY
KAT1 cDNA ORF Clone, Human, N-HA tag HG15255-NY
KAT1 cDNA ORF Clone, Human, C-Myc tag HG15255-CM
KAT1 cDNA ORF Clone, Human, N-Myc tag HG15255-NM
KAT1 qPCR Primer Pairs, Human HP103881
info info
添加购物车成功! 添加购物车失败!