휴먼 B7H7 / HHLA2 Gene ORF cDNA clone expression plasmid

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
데이터시트리뷰관련제품프로토콜
휴먼 HHLA2 cDNA 클론 제품 정보
Gene_bank_ref_id:BC035971.1
cDNA 크기:1245bp
cDNA 설명:Full length Clone DNA of Homo sapiens HERV-H LTR-associating 2.
유전자 동의어:B7H7
:Human
벡터:pCMV3-untagged
Plasmid:pCMV3-HHLA2
제한 사이트:KpnI + XbaI(6.1kb+1.25kb)
태그 씨퀀스:
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
연구배경

B7H7 gene encodes a protein ligand found on the surface of monocytes. The encoded protein is thought to regulate cell-mediated immunity by binding to a receptor on T lymphocytes and inhibiting the proliferation of these cells. Alternate splicing results in multiple transcript variants.
HERV–H LTR-associating 2 (HHLA2, also called B7H7/B7-H5/B7y)has been recently discovered as the newest member of the B7 family and has 23–33% similarity in amino acid sequence with the other B7 molecules. This ligand is the only B7 family member that is found in humans but not in mice. It is constitutively expressed on the surface of human monocytes and is induced on B cells. HHLA2 binds to its putative receptor(s) on a variety of immune cells including CD4 and CD8 T cells and antigen-presenting cells. Similarly to B7-H3, both a T cell coinhibitory role as well as a costimulatory role has been reported for this ligand.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

참고자료
  • Janakiram M, Chinai JM, Fineberg S, et al. Expression, clinical significance, and receptor identification of the newest B7 family member HHLA2 protein. Clinical cancer research : an official journal of the American Association for Cancer Research. 2015;21(10):2359-2366.
  • Size / Price
    Cat No: HG16139-UT
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".