C3orf37 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16328-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All C3orf37 Reagents

CRO Services

Product recommended


All C3orf37 Reagents

C3orf37 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1065 bp
Description
Full length Clone DNA of Human 5-hydroxymethylcytosine (hmC) binding, ES cell-specific with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C3orf37 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

C3orf37 cDNA ORF Clone, Human;DC12 cDNA ORF Clone, Human;SRAPD1 cDNA ORF Clone, Human

C3orf37 Background Information

Full Name
5-hydroxymethylcytosine (hmC) binding, ES cell-specific

C3orf37 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
C3orf37 cDNA ORF Clone in Cloning Vector, Mouse MG53206-G
C3orf37 cDNA ORF Clone, Mouse, untagged MG53206-UT
C3orf37 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53206-ACGLN
C3orf37 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53206-ACG
C3orf37 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53206-ANG
C3orf37 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53206-ACR
C3orf37 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53206-ANR
C3orf37 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53206-CF
C3orf37 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53206-NF
C3orf37 cDNA ORF Clone, Mouse, C-His tag MG53206-CH
C3orf37 cDNA ORF Clone, Mouse, N-His tag MG53206-NH
C3orf37 cDNA ORF Clone, Mouse, C-HA tag MG53206-CY
C3orf37 cDNA ORF Clone, Mouse, N-HA tag MG53206-NY
C3orf37 cDNA ORF Clone, Mouse, C-Myc tag MG53206-CM
C3orf37 cDNA ORF Clone, Mouse, N-Myc tag MG53206-NM

C3orf37 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
C3orf37 cDNA ORF Clone in Cloning Vector, Human HG16328-G
C3orf37 cDNA ORF Clone, Human, untagged HG16328-UT
C3orf37 cDNA ORF Clone, Human, C-GFPSpark® tag HG16328-ACG
C3orf37 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16328-ACGLN
C3orf37 cDNA ORF Clone, Human, N-GFPSpark® tag HG16328-ANG
C3orf37 cDNA ORF Clone, Human, C-OFPSpark® tag HG16328-ACR
C3orf37 cDNA ORF Clone, Human, N-OFPSpark® tag HG16328-ANR
C3orf37 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16328-CF
C3orf37 cDNA ORF Clone, Human, C-His tag HG16328-CH
C3orf37 cDNA ORF Clone, Human, N-His tag HG16328-NH
C3orf37 cDNA ORF Clone, Human, C-HA tag HG16328-CY
C3orf37 cDNA ORF Clone, Human, N-HA tag HG16328-NY
C3orf37 cDNA ORF Clone, Human, C-Myc tag HG16328-CM
C3orf37 cDNA ORF Clone, Human, N-Myc tag HG16328-NM
C3orf37 qPCR Primer Pairs, Human HP105081
info info
添加购物车成功! 添加购物车失败!